rnhA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rnhA |
|---|---|
| Mnemonic |
RNase H |
| Synonyms |
ECK0214, b0214, JW0204, cer, dasF, herA, rnh, sdrA, sin, G306[1][2] |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
5.08 minutes |
MG1655: 236002..235535 |
||
|
NC_012967: 238926..238459 |
||||
|
NC_012759: 235534..236001 |
||||
|
W3110 |
|
W3110: 236002..235535 |
||
|
DH10B: 210106..209639 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
235535 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rnhA(del) (Keio:JW0204) |
deletion |
deletion |
|||||
|
rnhAE48Q |
E48Q |
Loss of activity |
seeded from UniProt:P0A7Y4 | ||||
|
rnhAD70N |
D70N |
Loss of activity |
seeded from UniProt:P0A7Y4 | ||||
|
rnhAH124A |
H124A |
Reduces activity |
seeded from UniProt:P0A7Y4 | ||||
|
rnhAN130A |
N130A |
Reduces activity |
seeded from UniProt:P0A7Y4 | ||||
|
rnhAD134A |
D134A |
Loss of activity |
seeded from UniProt:P0A7Y4 | ||||
|
rnhAD134H,N |
D134H,N |
Slight decrease of activity |
seeded from UniProt:P0A7Y4 | ||||
|
rnhAD10N |
D10N |
Loss of activity |
seeded from UniProt:P0A7Y4 | ||||
|
rnhA1 |
|||||||
|
rnhA733(del)::kan |
|||||||
|
rnh-1 dnaA508 |
insertion |
Origin Indepedence |
rnh mutation allows oriC-independent replication |
See table 2. | |||
|
rnh-59 dnaA508 |
insertion |
Origin Indepedence |
rnh mutation allows oriC-independent replication |
See table 2. | |||
|
rnh-91 (amber) dnaA508 |
insertion |
Origin Indepedence |
The mutation caused differing origins or replication. |
See table 2. | |||
|
rnh-224 (UGA) dnaA508 |
insertion |
Origin Indepedence |
The mutation caused differing origins or replication. |
See table 2. | |||
|
rnh-339::cat dnaA508 |
insertion |
Origin Indepedence |
The mutation caused differing origins or replication. |
See table 2. | |||
|
rnh-1 recB270 |
RNase H activity |
Decreased activity of RNAse H. |
The mutation conferred a decrease in RNase H activity by 10 percent. See table 3. | ||||
|
rnh-59 recB270 |
RNase H activity |
Decreased activity of RNAse H. |
The mutation conferred a decrease in RNase H activity. See table 3. | ||||
|
rnh-91 recB270 |
RNase H activity |
Decreased activity of RNAse H. |
The mutation conferred a decrease in RNase H activity. See table 3. | ||||
|
rnh-224 recB270 |
RNase H activity |
Decreased activity of RNAse H. |
The mutation conferred a decrease in RNase H activity. See table 3. | ||||
|
rnh-339::cat recB270 |
RNase H activity |
Decreased activity of RNAse H. |
The mutation conferred a decrease in RNase H activity. See table 3. | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0204 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCTTAAACAGGTAGAAATTTT Primer 2:CCAACTTCAACTTGGTAGCCTGT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 89% [9] | ||
|
Linked marker |
est. P1 cotransduction: 40% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Kanaya, S et al. (1990) Role of cysteine residues in ribonuclease H from Escherichia coli. Site-directed mutagenesis and chemical modification. Biochem. J. 271 59-66 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 5.3 5.4 5.5 5.6 5.7 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 6.2 6.3 6.4 6.5 6.6 6.7 6.8 6.9 Itaya, M & Crouch, RJ (1991) Correlation of activity with phenotypes of Escherichia coli partial function mutants of rnh, the gene encoding RNase H. Mol. Gen. Genet. 227 433-7 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
