rlmN:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
rlmN |
---|---|
Gene Synonym(s) |
ECK2513, b2517, JW2501, yfgB[1], JW2501, yfgB |
Product Desc. | |
Product Synonyms(s) |
predicted enzyme[1], B2517[2][1], YfgB[2][1] , ECK2513, JW2501, yfgB, b2517 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
rlmN |
---|---|
Mnemonic |
rRNA large-subunit methylation |
Synonyms |
ECK2513, b2517, JW2501, yfgB[1], JW2501, yfgB |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
56.93 minutes |
MG1655: 2642305..2641151 |
||
NC_012759: 2526956..2528110 |
||||
W3110 |
|
W3110: 2642939..2641785 |
||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔyfgB (Keio:JW2501) |
deletion |
deletion |
PMID:16738554 |
||||
yfgB::Tn5KAN-I-SceI (FB20783) |
Insertion at nt 617 in Plus orientation |
PMID:15262929 |
contains pKD46 | ||||
yfgB::Tn5KAN-I-SceI (FB20783) |
Insertion at nt 617 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
ΔyfgB763::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW2501 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCTCTGAACAATTAGTCACACC Primer 2:CCGACCGCTTTAATGTCGATGGC | |
Linked marker |
est. P1 cotransduction: 12% [5] | ||
Linked marker |
est. P1 cotransduction: 44% [5] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG12401 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12401 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120002263 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB2301 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0008287 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
YfgB |
---|---|
Synonyms |
predicted enzyme[1], B2517[2][1], YfgB[2][1] , ECK2513, JW2501, yfgB, b2517 |
Product description | |
EC number (for enzymes) |
|
edit table |
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki. <protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0005506 |
iron ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0408 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01849 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR004383 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0046677 |
response to antibiotic |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0046 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0046872 |
metal ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0479 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051536 |
iron-sulfur cluster binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007197 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051536 |
iron-sulfur cluster binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0411 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051539 |
4 iron, 4 sulfur cluster binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0004 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0070475 |
rRNA base methylation |
PMID:18025251 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
lysS |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rfaD |
PMID:19402753 |
MALDI(Z-score):25.932326 | |
Protein |
rpmC |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
hupA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpmB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsT |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsP |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
infB |
PMID:19402753 |
MALDI(Z-score):26.605010 | |
Protein |
elaB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):30.986328 | |
Protein |
rpsJ |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):17.053160 | |
Protein |
rpsN |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplU |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
secA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):16.723487 | |
Protein |
clpB |
PMID:19402753 |
MALDI(Z-score):22.784016 | |
Protein |
rplS |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):9.192511 | |
Protein |
rpsM |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):23.490134 | |
Protein |
rplI |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):30.179799 | |
Protein |
rpsD |
PMID:19402753 |
LCMS(ID Probability):99.2 MALDI(Z-score):35.892124 | |
Protein |
rpsF |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
fusA |
PMID:19402753 |
MALDI(Z-score):26.914739 | |
Protein |
rplB |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):34.015328 | |
Protein |
hinT |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
tufB |
PMID:19402753 |
MALDI(Z-score):22.219262 | |
Protein |
rplX |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):14.946552 | |
Protein |
rplM |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):21.399261 | |
Protein |
rplO |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):13.986539 | |
Protein |
rplA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):39.836453 | |
Protein |
pstB |
PMID:19402753 |
MALDI(Z-score):28.023991 | |
Protein |
rpsC |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):38.942739 | |
Protein |
rplT |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
nuoC |
PMID:19402753 |
MALDI(Z-score):38.228192 | |
Protein |
recA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):35.679941 | |
Protein |
mreB |
PMID:19402753 |
MALDI(Z-score):37.383035 | |
Protein |
rplE |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):30.745275 | |
Protein |
rplR |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplF |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):8.450310 | |
Protein |
gyrB |
PMID:19402753 |
MALDI(Z-score):18.463811 | |
Protein |
rplW |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsR |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
dnaJ |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):37.449591 | |
Protein |
rcsB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplQ |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
dapF |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rlmL |
PMID:19402753 |
MALDI(Z-score):27.542715 | |
Protein |
rpmA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
clpA |
PMID:19402753 |
MALDI(Z-score):27.167522 | |
Protein |
ompC |
PMID:19402753 |
MALDI(Z-score):30.094344 | |
Protein |
rplD |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):25.533076 | |
Protein |
metK |
PMID:19402753 |
MALDI(Z-score):38.312024 | |
Protein |
skp |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
yfiF |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):27.671956 | |
Protein |
yhbY |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
yhiR |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):27.859002 | |
Protein |
srmB |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):31.809558 | |
Protein |
rnr |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):28.990622 | |
Protein |
infC |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
fruR |
PMID:19402753 |
MALDI(Z-score):24.026284 | |
Protein |
deaD |
PMID:19402753 |
MALDI(Z-score):26.413910 | |
Protein |
rluB |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):37.990218 | |
Protein |
hrpA |
PMID:19402753 |
MALDI(Z-score):18.791775 | |
Protein |
pnp |
PMID:19402753 |
MALDI(Z-score):28.088568 | |
Protein |
yibL |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):3.299484 | |
Protein |
spoT |
PMID:19402753 |
MALDI(Z-score):25.925192 | |
Protein |
ydcP |
PMID:19402753 |
MALDI(Z-score):21.312156 | |
Protein |
selB |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):24.293550 | |
Protein |
phoR |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
tsr |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
wcaD |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
melB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
nupX |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplL |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
edit table |
See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki. </protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
See Help:Product_localization for how to add or edit information in this section of EcoliWiki. <protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MSEQLVTPEN VTTKDGKINL LDLNRQQMRE FFKDLGEKPF RADQVMKWMY HYCCDNFDEM TDINKVLRGK LKEVAEIRAP EVVEEQRSSD GTIKWAIAVG DQRVETVYIP EDDRATLCVS SQVGCALECK FCSTAQQGFN RNLRVSEIIG QVWRAAKIVG AAKVTGQRPI TNVVMMGMGE PLLNLNNVVP AMEIMLDDFG FGLSKRRVTL STSGVVPALD KLGDMIDVAL AISLHAPNDE IRDEIVPINK KYNIETFLAA VRRYLEKSNA NQGRVTIEYV MLDHVNDGTE HAHQLAELLK DTPCKINLIP WNPFPGAPYG RSSNSRIDRF SKVLMSYGFT TIVRKTRGDD IDAACGQLAG DVIDRTKRTL RKRMQGEAID IKAV |
Length |
384 |
Mol. Wt |
43.085 kDa |
pI |
3.5 (calculated) |
Extinction coefficient |
33,920 - 34,920 (calc based on 8 Y, 4 W, and 8 C residues) |
edit table |
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki. | </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki. <protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0008287 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG12401 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12401 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120002263 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB2301 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
See Help:Product_accessions for help entering or editing information in this section of EcoliWiki. <protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
Ecoli K-12 |
27.658+/-0.195 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.089688042 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 MG1655 |
3887 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
544 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
1377 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:2642285..2642325
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for yfgB | |
microarray |
Summary of data for yfgB from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
GFP Fusion |
Intergenic region (2642213..2642518) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
edit table |
<protect></protect>
Notes
Accessions Related to rlmN Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG12401 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB2301 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12401 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120002263 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0008287 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
Macaca mulatta |
|
From Inparanoid:20070104 |
Oryza gramene |
|
From Inparanoid:20070104 |
Xenopus tropicalis |
|
From Inparanoid:20070104 |
Shigella flexneri |
YFGB |
From SHIGELLACYC |
E. coli O157 |
YFGB |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG12401 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12401 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120002263 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB2301 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0008287 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories
- Genes in OpenBioSystems with Promoter Fusions
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Macaca mulatta
- Genes with homologs in Oryza gramene
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157