rho:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rho |
|---|---|
| Mnemonic |
Rho termination factor |
| Synonyms |
ECK3775, b3783, JW3756, nitA, nusD, psuA, rnsC, sun, tsu, psu, sbaA, suA[1], hdf, tabC |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
85.45 minutes |
MG1655: 3964440..3965699 |
||
|
NC_012967: 3928217..3929476 |
||||
|
NC_012759: 3854109..3855368 |
||||
|
W3110 |
|
W3110: 3670264..3669005 |
||
|
DH10B: 4063360..4064619 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3964440 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rhoF64L,A |
F64L,A |
Defective for RNA-binding |
seeded from UniProt:P0AG30 | ||||
|
rhoK181Q |
K181Q |
Partial loss of ATPase, helicase and termination activity |
seeded from UniProt:P0AG30 | ||||
|
rhoK184Q |
K184Q |
Improves ATPase and helicase activity but reduced termination activity |
seeded from UniProt:P0AG30 | ||||
|
rhoF62L,A |
F62L,A |
Defective for RNA-binding |
seeded from UniProt:P0AG30 | ||||
|
rhoD265N |
D265N |
Loss of ATPase activity, helicase and termination activity |
seeded from UniProt:P0AG30 | ||||
|
rho-15(Ts) |
IS1 insertion into C-terminus |
changes seven amino acids, eliminates the last two (changes DFFEMMKRS to EVMTPTY) |
Growth Phenotype |
fails to grow at 42oC, grows slowly at 30oC, suppresses polarity |
quickly loses temperature-sensitive phenotype due to accumulation of suppressor mutations.[7] | ||
|
rho-4 |
C to A transversion in codon 243 |
A243E |
polarity suppression |
suppresses polarity, defective for termination at Rho-dependent terminators |
Originally thought to be an amber (UAG) mutation,[8] but later found to be a missense mutation.[9][10] | ||
|
rho-112(Am) |
amber (UAG) mutation | ||||||
|
rho-702(ts) |
Growth Phenotype |
temperature sensitive |
|||||
|
rho-6 |
|||||||
|
rho026 (aka rhoHDF026 |
Increased degradation of abnormal proteins, such as puromycyl polypeptides or canavanine-containing polypeptides. |
||||||
|
rho026 (aka rhoHDF026) |
P103L, S153Y |
Unable to support growth of phage T4 and inhibits Lambda phage N activity. Uninfected cells were temperature-sensitive for growth at 42°C in original isolate.
|
P103L change is responsible for interfering with T4 plating and Lambda N-mediated antitermination. S153Y was acquired as a suppressor of ts phenotype. | ||||
|
sbaA mutation in SDT1 |
deletion |
Growth Phenotype |
deletion of sbaA gene causes limited growth at higher temperatures. |
See fig 2B for gel electrophoresis results. | |||
|
sbaA mutation in SDT1 |
deletion |
metabolism |
Increase in the accumulation of pppGpp |
See Fig 3 A & B for full experimental results. | |||
|
sbaA mutation in SDT1 |
deletion |
beta-galactosidase activity |
decrease in the beta-galactosidase activity |
See Fig 4 for full results. | |||
|
sbaA mutation in SDT1 |
deletion |
beta-galactosidase activity |
addition of 1.0 mM cAMP causes increased beta-galactosidase activity but was significantly lower than parent strain. |
See Fig 4 for full results. | |||
| edit table |
<protect></protect>
Notes
The Keio deletion appears to be the result of a gene duplication, wt rho is still present in the strain.[16]
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3756 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAATCTTACCGAATTAAAGAA Primer 2:CCTGAGCGTTTCATCATTTCGAA | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 67% [20] | ||
|
metEo-3079::Tn10 |
Linked marker |
est. P1 cotransduction: 14% [20] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Brown, S et al. (1982) Localization and regulation of the structural gene for transcription-termination factor rho of Escherichia coli. J. Mol. Biol. 162 283-98 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Pichoff, S et al. (1998) An Escherichia coli gene (yaeO) suppresses temperature-sensitive mutations in essential genes by modulating Rho-dependent transcription termination. Mol. Microbiol. 29 859-69 PubMed
- ↑ Das, A et al. (1976) Isolation and characterization of conditional lethal mutants of Escherichia coli defective in transcription termination factor rho. Proc. Natl. Acad. Sci. U.S.A. 73 1959-63 PubMed
- ↑ Opperman, T et al. (1995) The ts15 mutation of Escherichia coli alters the sequence of the C-terminal nine residues of Rho protein. Gene 152 133-4 PubMed
- ↑ Stewart, V & Yanofsky, C (1985) Evidence for transcription antitermination control of tryptophanase operon expression in Escherichia coli K-12. J. Bacteriol. 164 731-40 PubMed
- ↑ 8.0 8.1 Morse, DE & Guertin, M (1972) Amber suA mutations which relieve polarity. J. Mol. Biol. 63 605-8 PubMed
- ↑ 9.0 9.1 Ratner, D (1976) Evidence that mutations in the suA polarity suppressing gene directly affect termination factor rho. Nature 259 151-3 PubMed
- ↑ 10.0 10.1 Harinarayanan, R & Gowrishankar, J (2003) Host factor titration by chromosomal R-loops as a mechanism for runaway plasmid replication in transcription termination-defective mutants of Escherichia coli. J. Mol. Biol. 332 31-46 PubMed
- ↑ Simon, LD et al. (1979) Hyperdegradation of proteins in Escherichia coli rho mutants. Proc. Natl. Acad. Sci. U.S.A. 76 1623-7 PubMed
- ↑ Stitt, BL et al. (1980) Role of the host cell in bacteriophage T4 development. II. Characterization of host mutants that have pleiotropic effects on T4 growth. J. Virol. 35 775-89 PubMed
- ↑ Das, A et al. (1983) lambda mutation in the Escherichia coli rho gene that inhibits the N protein activity of phage lambda. Proc. Natl. Acad. Sci. U.S.A. 80 5530-4 PubMed
- ↑ Washburn, RS & Stitt, BL (1996) In vitro characterization of transcription termination factor Rho from Escherichia coli rho(nusD) mutants. J. Mol. Biol. 260 332-46 PubMed
- ↑ 15.0 15.1 15.2 15.3 Danchin, A & Dondon, L (1980) Serine sensitivity of Escherichia coli K 12: partial characterization of a serine resistnat mutant that is extremely sensitive to 2-ketobutyrate. Mol. Gen. Genet. 178 155-64 PubMed
- ↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 18.0 18.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 19.0 19.1 CGSC: The Coli Genetics Stock Center
- ↑ 20.0 20.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).