recB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
recB |
|---|---|
| Mnemonic |
Recombination |
| Synonyms |
ECK2816, b2820, JW2788, rorA, ior[1], ior |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
63.59 minutes |
MG1655: 2954025..2950483 |
||
|
NC_012967: 2850622..2847080 |
||||
|
NC_012759: 2837631..2841173 |
||||
|
W3110 |
|
W3110: 2954659..2951117 |
||
|
DH10B: 3047895..3044353 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2950486 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
recB(del) (Keio:JW2788) |
deletion |
deletion |
|||||
|
recB::Tn5KAN-I-SceI (FB20945) |
Insertion at nt 2423 in Minus orientation |
contains pKD46 | |||||
|
recB::Tn5KAN-I-SceI (FB20946) |
Insertion at nt 2423 in Minus orientation |
does not contain pKD46 | |||||
|
recB21 |
|||||||
|
recB270(ts) |
temperature sensitive |
||||||
|
recB1067(D1067A) |
|||||||
|
recB1080(D1080A) |
|||||||
|
recB1082(K1082Q) |
|||||||
|
recB60 |
|||||||
|
recB745(del)::kan |
|||||||
|
recB in MDS42 |
deletion |
Sensitivity to |
increases sensitivity to bicyclomycin |
fig. 2 | |||
|
recB |
deletion |
Sensitivity to |
decreases sensitivity to Bicyclomycin |
fig 2 | |||
|
nrdA101 recB(del) |
recB function is deactivated |
Rate of DNA replication |
When exposed to extreme temperatures the rate of transcription is slightly under restrictive conditions |
See Figure 2 | |||
|
recB268::Tn10 |
Tn10 was inserted into the recB gene at the allele 268. |
Growth Phenotype |
the rate of growth was significantly decreased. |
See figure 1. The strain background is Hfr3000; called '3000HfrH' in the paper. | |||
|
SMR6039 recB(del)::Kan |
Deletion |
SOS response |
Decrease in spontaneous SOS-induction defective |
Parent Strain: SMR6039 Experimental Strain: SMR16024 |
The mutation caused a defect in Spontaneous SOS-Induction. See table S7 for a summary of experimental results. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2788 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTGATGTCGCCGAGACACT Primer 2:CCgGCCTCCTCCAGGGTCATACC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 52% [15] | ||
|
Linked marker |
est. P1 cotransduction: 99% [15] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Masterson, C et al. (1992) Reconstitution of the activities of the RecBCD holoenzyme of Escherichia coli from the purified subunits. J. Biol. Chem. 267 13564-72 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 6.0 6.1 Yu, M et al. (1998) Identification of the nuclease active site in the multifunctional RecBCD enzyme by creation of a chimeric enzyme. J. Mol. Biol. 283 797-808 PubMed
- ↑ Jockovich, ME & Myers, RS (2001) Nuclease activity is essential for RecBCD recombination in Escherichia coli. Mol. Microbiol. 41 949-62 PubMed
- ↑ Washburn, RS & Gottesman, ME (2011) Transcription termination maintains chromosome integrity. Proc. Natl. Acad. Sci. U.S.A. 108 792-7 PubMed
- ↑ Tran, L et al. (2011) Single-gene deletion mutants of Escherichia coli with altered sensitivity to bicyclomycin, an inhibitor of transcription termination factor Rho. J. Bacteriol. 193 2229-35 PubMed
- ↑ Salguero, I et al. (2011) RecA-dependent replication in the nrdA101(Ts) mutant of Escherichia coli under restrictive conditions. J. Bacteriol. 193 2851-60 PubMed
- ↑ Dermić, D & Trgovcević, Z (1999) Specific effects of a recB mutation on the HfrH strain of Escherichia coli. J. Bacteriol. 181 1334-7 PubMed
- ↑ Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 14.0 14.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 15.0 15.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
