rcsB:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
rcsB |
---|---|
Gene Synonym(s) |
ECK2210, b2217, JW2205[1], JW2205, viaA |
Product Desc. |
Positive regulatory gene for capsule (colanic acid) synthesis; when overexpressed, restores ftsZ84 growth on low-salt medium[4] |
Product Synonyms(s) |
DNA-binding response regulator in two-component regulatory system with RcsC and YojN[1], B2217[2][1], RcsB[2][1], positive response regulator for colanic capsule biosynthesis, (sensor, RcsC)[2][1], regulator protein RcsB[2][1], unphosphorylated regulator protein RcsB[2][1], unmodified regulator protein RcsB[2][1] , ECK2210, JW2205, viaA, b2217 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Binds TrxA (Kumar, 2004). HT_Cmplx42_Mem: RcsB+YfgM.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
rcsB |
---|---|
Mnemonic |
Regulator of capsule synthesis |
Synonyms |
ECK2210, b2217, JW2205[1], JW2205, viaA |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
49.88 minutes |
MG1655: 2314199..2314849 |
||
NC_012759: 2200004..2200654 |
||||
W3110 |
|
W3110: 2319511..2320161 |
||
DH10B: 2405187..2405837 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔrcsB (Keio:JW2205) |
deletion |
deletion |
PMID:16738554 |
||||
rcsB::Tn5KAN-2 (FB20713) |
Insertion at nt 502 in Plus orientation |
PMID:15262929 |
contains pKD46 | ||||
ΔrcsB1320 |
|||||||
ΔrcsB770::kan |
PMID:16738554 |
||||||
RcsB |
A deletion 25 base pairs upstream of the ftsA1p -35 box |
Gene Expression |
A deletion within 25 base pairs upstream of the -35 box ceased RcsB activity, especially if it was within 15 base pairs or less of the box. |
PMID:10564486 |
See figure 1 | ||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW2205 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAACAATATGAACGTAATTAT Primer 2:CCGTCTTTATCTGCCGGACTTAA | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 64% [6] | ||
Linked marker |
est. P1 cotransduction: 83% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10821 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10821 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000812 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0814 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0007333 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
RcsB |
---|---|
Synonyms |
DNA-binding response regulator in two-component regulatory system with RcsC and YojN[1], B2217[2][1], RcsB[2][1], positive response regulator for colanic capsule biosynthesis, (sensor, RcsC)[2][1], regulator protein RcsB[2][1], unphosphorylated regulator protein RcsB[2][1], unmodified regulator protein RcsB[2][1] , ECK2210, JW2205, viaA, b2217 |
Product description |
Positive regulatory gene for capsule (colanic acid) synthesis; when overexpressed, restores ftsZ84 growth on low-salt medium[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000156 |
two-component response regulator activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001789 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000160 |
two-component signal transduction system (phosphorelay) |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001789 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000160 |
two-component signal transduction system (phosphorelay) |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0902 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005622 |
intracellular |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001789 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0043565 |
sequence-specific DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of RcsB |
could be indirect |
||
Protein |
dnaK |
PMID:15690043 |
Experiment(s):EBI-879136 | |
Protein |
glnB |
PMID:15690043 |
Experiment(s):EBI-879136 | |
Protein |
rplC |
PMID:15690043 |
Experiment(s):EBI-879136 | |
Protein |
rplM |
PMID:15690043 |
Experiment(s):EBI-879136, EBI-882754 | |
Protein |
rpsC |
PMID:15690043 |
Experiment(s):EBI-879136, EBI-882754 | |
Protein |
rpsD |
PMID:15690043 |
Experiment(s):EBI-879136 | |
Protein |
rpsJ |
PMID:15690043 |
Experiment(s):EBI-879136 | |
Protein |
rpsU |
PMID:15690043 |
Experiment(s):EBI-879136 | |
Protein |
tufA |
PMID:15690043 |
Experiment(s):EBI-879136 | |
Protein |
yojN |
PMID:15690043 |
Experiment(s):EBI-879136 | |
Protein |
yfaW |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
yfaY |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
ygfK |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
crp |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
lldP |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
tilS |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
mgtA |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
polA |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
prmA |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
rplE |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
rplI |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
rplS |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
rplV |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
rpmB |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
rpoA |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
yagA |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
ssuD |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
etk |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
gadE |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
yhjQ |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
gfcD |
PMID:15690043 |
Experiment(s):EBI-882754 | |
Protein |
yeaO |
PMID:16606699 |
Experiment(s):EBI-1142206 | |
Protein |
ygfK |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
tufB |
PMID:19402753 |
MALDI(Z-score):18.961569 | |
Protein |
rpmB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
prmA |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
rpsC |
PMID:19402753 |
LCMS(ID Probability):99.0 MALDI(Z-score):28.025444 | |
Protein |
rplM |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):7.187864 | |
Protein |
rplA |
PMID:19402753 |
MALDI(Z-score):24.686073 | |
Protein |
rpsD |
PMID:19402753 |
MALDI(Z-score):31.453572 | |
Protein |
rhmD |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
ssuD |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
lldP |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
tilS |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
etk |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
yagA |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
mgtA |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
gfcD |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
gadE |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
rcsD |
PMID:19402753 |
MALDI(Z-score):18.897267 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
cytoplasm |
From EcoCyc[3] |
| ||
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MNNMNVIIAD DHPIVLFGIR KSLEQIEWVN VVGEFEDSTA LINNLPKLDA HVLITDLSMP GDKYGDGITL IKYIKRHFPS LSIIVLTMNN NPAILSAVLD LDIEGIVLKQ GAPTDLPKAL AALQKGKKFT PESVSRLLEK ISAGGYGDKR LSPKESEVLR LFAEGFLVTE IAKKLNRSIK TISSQKKSAM MKLGVENDIA LLNYLSSVTL SPADKD |
Length |
216 |
Mol. Wt |
23.671 kDa |
pI |
7.5 (calculated) |
Extinction coefficient |
11,460 (calc based on 4 Y, 1 W, and 0 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0007333 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10821 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10821 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000812 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0814 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
1.49E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
Ecoli K-12 |
368.665+/-1.5 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.16136+/-0.00722 |
Molecules/cell |
|
by FISH |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.331538462 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 MG1655 |
5968 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
2820 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
3526 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:2314179..2314219
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for rcsB | |
microarray |
Summary of data for rcsB from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to rcsB Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10821 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0814 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10821 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000812 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0007333 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
Shigella flexneri |
RCSB |
From SHIGELLACYC |
E. coli O157 |
RCSB |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10821 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10821 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000812 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0814 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0007333 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories