{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	rcsB
Gene Synonym(s)	ECK2210, b2217, JW2205^[1], JW2205, viaA
Product Desc.	RcsB^[2]^[3]; Component of RcsB^[2]^[3] Positive regulatory gene for capsule (colanic acid) synthesis; when overexpressed, restores ftsZ84 growth on low-salt medium^[4]
Product Synonyms(s)	DNA-binding response regulator in two-component regulatory system with RcsC and YojN^[1], B2217^[2]^[1], RcsB^[2]^[1], positive response regulator for colanic capsule biosynthesis, (sensor, RcsC)^[2]^[1], regulator protein RcsB^[2]^[1], unphosphorylated regulator protein RcsB^[2]^[1], unmodified regulator protein RcsB^[2]^[1] , ECK2210, JW2205, viaA, b2217
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): rcsB^[2], rcsDB^[3]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Binds TrxA (Kumar, 2004). HT_Cmplx42_Mem: RcsB+YfgM.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	rcsB
Mnemonic	Regulator of capsule synthesis
Synonyms	ECK2210, b2217, JW2205^[1], JW2205, viaA
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	49.88 minutes	MG1655: 2314199..2314849 <gbrowseImage> name=NC_000913:2314199..2314849 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
BW2952		NC_012759: 2200004..2200654 <gbrowseImage> name=NC_012759:2200004..2200654 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 2319511..2320161 <gbrowseImage> name=NC_007779:2319511..2320161 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 2405187..2405837 <gbrowseImage> name=NC_010473:2405187..2405837 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
ΔrcsB (Keio:JW2205)	deletion	deletion			PMID:16738554	Shigen CGSC9783^[5]
rcsB::Tn5KAN-2 (FB20713)	Insertion at nt 502 in Plus orientation				PMID:15262929	E. coli Genome Project:FB20713	contains pKD46
ΔrcsB1320						CGSC:77155
ΔrcsB770::kan					PMID:16738554	CGSC:102612
RcsB	A deletion 25 base pairs upstream of the ftsA1p -35 box		Gene Expression	A deletion within 25 base pairs upstream of the -35 box ceased RcsB activity, especially if it was within 15 base pairs or less of the box.	PMID:10564486		See figure 1
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW2205	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAACAATATGAACGTAATTAT Primer 2:CCGTCTTTATCTGCCGGACTTAA
22A6	Kohara Phage	Genobase	PMID:3038334
5A1	Kohara Phage	Genobase	PMID:3038334
napA722::Tn10	Linked marker	CAG12098 = CGSC7400^[5]	est. P1 cotransduction: 64% ^[6] Synonyms:zeg-722, zei-722::Tn10
atoS298::Tn10	Linked marker	CAG12177 gyrA+ = CGSC7525^[5]	est. P1 cotransduction: 83% ^[6] Synonyms:zeh-298::Tn10, zej-298::Tn10 nnnThe original CAG12177 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC).
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10821	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10821	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000812	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:947441	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0814	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0007333	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	RcsB
Synonyms	DNA-binding response regulator in two-component regulatory system with RcsC and YojN^[1], B2217^[2]^[1], RcsB^[2]^[1], positive response regulator for colanic capsule biosynthesis, (sensor, RcsC)^[2]^[1], regulator protein RcsB^[2]^[1], unphosphorylated regulator protein RcsB^[2]^[1], unmodified regulator protein RcsB^[2]^[1] , ECK2210, JW2205, viaA, b2217
Product description	RcsB^[2]^[3]; Component of RcsB^[2]^[3] Positive regulatory gene for capsule (colanic acid) synthesis; when overexpressed, restores ftsZ84 growth on low-salt medium^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0000156	two-component response regulator activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001789	F	Seeded from EcoCyc (v14.0)	complete
	GO:0000160	two-component signal transduction system (phosphorelay)	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001789	P	Seeded from EcoCyc (v14.0)	complete
	GO:0000160	two-component signal transduction system (phosphorelay)	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0902	P	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0238	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003700	transcription factor activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000792	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005622	intracellular	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000792	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006350	transcription	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0804	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006355	regulation of transcription, DNA-dependent	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000792	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006355	regulation of transcription, DNA-dependent	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001789	P	Seeded from EcoCyc (v14.0)	complete
	GO:0043565	sequence-specific DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000792	F	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of RcsB	could be indirect
Protein	dnaK		PMID:15690043^[7]	Experiment(s):EBI-879136
Protein	glnB		PMID:15690043^[7]	Experiment(s):EBI-879136
Protein	rplC		PMID:15690043^[7]	Experiment(s):EBI-879136
Protein	rplM		PMID:15690043^[7]	Experiment(s):EBI-879136, EBI-882754
Protein	rpsC		PMID:15690043^[7]	Experiment(s):EBI-879136, EBI-882754
Protein	rpsD		PMID:15690043^[7]	Experiment(s):EBI-879136
Protein	rpsJ		PMID:15690043^[7]	Experiment(s):EBI-879136
Protein	rpsU		PMID:15690043^[7]	Experiment(s):EBI-879136
Protein	tufA		PMID:15690043^[7]	Experiment(s):EBI-879136
Protein	yojN		PMID:15690043^[7]	Experiment(s):EBI-879136
Protein	yfaW		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	yfaY		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	ygfK		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	crp		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	lldP		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	tilS		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	mgtA		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	polA		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	prmA		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	rplE		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	rplI		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	rplS		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	rplV		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	rpmB		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	rpoA		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	yagA		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	ssuD		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	etk		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	gadE		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	yhjQ		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	gfcD		PMID:15690043^[7]	Experiment(s):EBI-882754
Protein	yeaO		PMID:16606699^[8]	Experiment(s):EBI-1142206
Protein	ygfK		PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	tufB		PMID:19402753^[9]	MALDI(Z-score):18.961569
Protein	rpmB		PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	prmA		PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	rpsC		PMID:19402753^[9]	LCMS(ID Probability):99.0 MALDI(Z-score):28.025444
Protein	rplM		PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):7.187864
Protein	rplA		PMID:19402753^[9]	MALDI(Z-score):24.686073
Protein	rpsD		PMID:19402753^[9]	MALDI(Z-score):31.453572
Protein	rhmD		PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	ssuD		PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	lldP		PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	tilS		PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	etk		PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	yagA		PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	mgtA		PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	gfcD		PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	gadE		PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	rcsD		PMID:19402753^[9]	MALDI(Z-score):18.897267
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
cytoplasm			From EcoCyc^[3]
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MNNMNVIIAD DHPIVLFGIR KSLEQIEWVN VVGEFEDSTA LINNLPKLDA HVLITDLSMP GDKYGDGITL IKYIKRHFPS LSIIVLTMNN NPAILSAVLD LDIEGIVLKQ GAPTDLPKAL AALQKGKKFT PESVSRLLEK ISAGGYGDKR LSPKESEVLR LFAEGFLVTE IAKKLNRSIK TISSQKKSAM MKLGVENDIA LLNYLSSVTL SPADKD
Length	216
Mol. Wt	23.671 kDa
pI	7.5 (calculated)
Extinction coefficient	11,460 (calc based on 4 Y, 1 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	References
Domain	148..205	PF00196 Bacterial regulatory proteins, luxR family	PMID:19920124^[10]
Domain	6..121	PF00072 Response regulator receiver domain	PMID:19920124^[10]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=rcsB taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16130154	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:947441	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0007333	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P69407	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10821	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10821	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:947441	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000812	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0814	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	1.49E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	368.665+/-1.5	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.16136+/-0.00722	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by FISH	PMID:20671182
mRNA	Ecoli K-12	0.331538462	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	5968	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	2820	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	3526	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
rcsB
rcsDB
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:2314179..2314219 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b2217 (EcoliWiki Page)	NCBI GEO profiles for rcsB
microarray	GenExpDB:b2217 (EcoliWiki Page)	Summary of data for rcsB from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to rcsB Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10821	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0814	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2217
EcoGene	EcoGene:EG10821	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000812	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0007333	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Arabidopsis thaliana	AT5G62920 (score: 1.000; bootstrap: 100%) AT3G48100 (score: 0.735) AT2G41310 (score: 0.379) AT3G57040 (score: 0.369) AT2G40670 (score: 0.346) AT3G56380 (score: 0.337) AT2G46790 (score: 0.065) AT2G07440 (score: 0.061)	From Inparanoid:20070104
Shigella flexneri	RCSB	From SHIGELLACYC
E. coli O157	RCSB	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00196 Bacterial regulatory proteins, luxR family
Superfamily (EcoliWiki Page)	SUPERFAMILY:46894
Superfamily (EcoliWiki Page)	SUPERFAMILY:52172
Panther (EcoliWiki Page)	PTHR24761:SF192
Pfam (EcoliWiki Page)	PF00072 Response regulator receiver domain
EcoCyc	EcoCyc:EG10821	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10821	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000812	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0814	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0007333	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 ^1.13 ^1.14 ^1.15 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 ^2.13 ^2.14 ^2.15 ^2.16 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 ^3.5 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^7.00 ^7.01 ^7.02 ^7.03 ^7.04 ^7.05 ^7.06 ^7.07 ^7.08 ^7.09 ^7.10 ^7.11 ^7.12 ^7.13 ^7.14 ^7.15 ^7.16 ^7.17 ^7.18 ^7.19 ^7.20 ^7.21 ^7.22 ^7.23 ^7.24 ^7.25 ^7.26 ^7.27 ^7.28 ^7.29 ^7.30 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^9.00 ^9.01 ^9.02 ^9.03 ^9.04 ^9.05 ^9.06 ^9.07 ^9.08 ^9.09 ^9.10 ^9.11 ^9.12 ^9.13 ^9.14 ^9.15 ^9.16 ^9.17 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ ^10.0 ^10.1 Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed

rcsB:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to rcsB Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search