pstB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
pstB |
|---|---|
| Mnemonic |
P-specific transport |
| Synonyms |
ECK3718, b3725, JW3703, phoT[1], phoT |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
84.18 minutes |
MG1655: 3906389..3905616 |
||
|
NC_012967: 3868733..3867960 |
||||
|
NC_012759: 3793949..3794722 |
||||
|
W3110 |
|
W3110: 3728315..3729088 |
||
|
DH10B: 4003973..4003200 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
pstB(del) (Keio:JW3703) |
deletion |
deletion |
|||||
|
pstB::Tn5KAN-I-SceI (FB21418) |
Insertion at nt 405 in Minus orientation |
contains pKD46 | |||||
|
pstB::Tn5KAN-I-SceI (FB21419) |
Insertion at nt 405 in Minus orientation |
does not contain pKD46 | |||||
|
pstBG48I |
G48I |
Loss of phosphate transport |
seeded from UniProt:P0AAH0 | ||||
|
pstBK49Q |
K49Q |
Loss of phosphate transport |
seeded from UniProt:P0AAH0 | ||||
|
pstB(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
pstB(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
pstB608(del-ins)::kan |
|||||||
|
pstB629(del-ins,::FRT) |
|||||||
|
pstB756(del)::kan |
|||||||
|
ptsB in strain 10B5 |
Resistant to |
Resistant to Arsenate |
Strain: 10B5 |
||||
|
pstB in strain UR1 |
Resistant to |
Resistant to Arsenate |
Strain: UR1 |
||||
|
pstB756(del)::FRT |
Mutagenesis rate |
Decreased stress-induced mutagenesis (SIM) phenotype. |
Parental Strain: SMR4562 Experimental Strain: SMR12232 |
Mutation Rate was comparatively weak, to other strains, with decrease only happening in 33-67% of wild type population. | |||
|
pstB756(del)::FRT |
Sensitivity to |
Increase sensitivity to UV. |
Experimental Strain: SMR12050 Parental strain: SMR4562 |
See Table S1 & S7 | |||
|
CAG45114 pstB756(del)::FRTKanFRT |
Deletion |
SigmaE activity |
Decrease in SigmaE activity |
Parental Strain: CAG45114 Experimental Strain: SMR15301 |
See table S11 for experimental data. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3703 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTATGGTTGAAACTGCCCC Primer 2:CCACCGTAACGACCGGTGATGTA | |
|
Kohara Phage |
|||
|
zid-501::Tn10 |
Linked marker |
est. P1 cotransduction: 29% [12] | |
|
Linked marker |
est. P1 cotransduction: 40% [12] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 5.0 5.1 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ 6.0 6.1 Datsenko, KA & Wanner, BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97 6640-5 PubMed
- ↑ Sprague, GF Jr et al. (1975) A mutant of Escherichia coli auxotrophic for organic phosphates: evidence for two defects in inorganic phosphate transport. Mol. Gen. Genet. 143 71-7 PubMed
- ↑ Willsky, GR et al. (1973) Inorganic phosphate transport in Escherichia coli: involvement of two genes which play a role in alkaline phosphatase regulation. J. Bacteriol. 113 529-39 PubMed
- ↑ 9.0 9.1 9.2 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 12.0 12.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
