plsB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
plsB |
|---|---|
| Mnemonic |
Phospholipid synthesis |
| Synonyms |
ECK4033, b4041, JW4001[1], JW4001 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
91.65 minutes |
MG1655: 4254489..4252066 |
||
|
NC_012967: 4235398..4232975 |
||||
|
NC_012759: 4190911..4193334 |
||||
|
W3110 |
|
W3110: 4260056..4257633 |
||
|
DH10B: 4354185..4351762 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4252069 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
plsB26 |
G1045A[3] |
Ala349Thr[3] |
Growth Phenotype |
Requires glycerol-3-phosphate for growth [4]. However, the block in phospholipid synthesis is only complete in a plsB gspA double mutant.[5] |
"The PlsB protein had a significantly reduced glycerol-3-phosphate acyltransferase activity coupled with an elevated Km for glycerol-3-phosphate."[3] |
||
|
plsBS308A |
S308A |
No effect |
seeded from UniProt:P0A7A7 | ||||
|
plsBD311A |
D311A |
Prevents assembly into the membrane, suggesting that it paticipates to folding |
seeded from UniProt:P0A7A7 | ||||
|
plsBD311G |
D311G |
Strongly reduced acyltransferase activity |
seeded from UniProt:P0A7A7 | ||||
|
plsBH306A |
H306A |
Abolishes acyltransferase activity |
seeded from UniProt:P0A7A7 | ||||
|
plsBH306G |
H306G |
Reduced acyltransferase activity |
seeded from UniProt:P0A7A7 | ||||
|
plsBA349T |
A349T |
In plsB26; results in high KM for glycerol-3-phosphate and reduced specific activity |
seeded from UniProt:P0A7A7 | ||||
|
plsBF351A |
F351A |
Strongly reduced acyltransferase activity |
seeded from UniProt:P0A7A7 | ||||
|
plsBI352A |
I352A |
Reduced acyltransferase activity |
seeded from UniProt:P0A7A7 | ||||
|
plsBR354C |
R354C |
Reduced acyltransferase activity |
seeded from UniProt:P0A7A7 | ||||
|
plsBR354K |
R354K |
No effect |
seeded from UniProt:P0A7A7 | ||||
|
plsBE385R |
E385R |
Strongly reduced acyltransferase activity |
seeded from UniProt:P0A7A7 | ||||
|
plsBG386A |
G386A |
No effect |
seeded from UniProt:P0A7A7 | ||||
|
plsBG386L |
G386L |
Reduced acyltransferase activity |
seeded from UniProt:P0A7A7 | ||||
|
plsBS389A |
S389A |
No effect |
seeded from UniProt:P0A7A7 | ||||
|
plsBP421S |
P421S |
Reduced acyltransferase activity |
seeded from UniProt:P0A7A7 | ||||
|
plsB13 |
|||||||
|
plsB26 |
|||||||
|
plsB26 |
G1045A |
Ala349Thr |
Growth Phenotype |
Glycerol-3-phosphate auxotrophs |
|||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4001 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCCGGCTGGCCACGAATTTA Primer 2:CCaCCTTCGCCCTGCGTCGCACT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 67% [10] | ||
|
Linked marker |
est. P1 cotransduction: 8% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Green, PR et al. (1983) Partial NH2- and COOH-terminal sequence and cyanogen bromide peptide analysis of Escherichia coli sn-glycerol-3-phosphate acyltransferase. J. Biol. Chem. 258 10862-6 PubMed
- ↑ 3.0 3.1 3.2 3.3 Heath, RJ & Rock, CO (1999) A missense mutation accounts for the defect in the glycerol-3-phosphate acyltransferase expressed in the plsB26 mutant. J. Bacteriol. 181 1944-6 PubMed
- ↑ Bell, RM (1974) Mutants of Escherichia coli defective in membrane phospholipid synthesis: macromolecular synthesis in an sn-glycerol 3-phosphate acyltransferase Km mutant. J. Bacteriol. 117 1065-76 PubMed
- ↑ Ray, TK & Cronan, JE Jr (1987) Acylation of glycerol 3-phosphate is the sole pathway of de novo phospholipid synthesis in Escherichia coli. J. Bacteriol. 169 2896-8 PubMed
- ↑ Larson, TJ et al. (1984) sn-Glycerol-3-phosphate auxotrophy of plsB strains of Escherichia coli: evidence that a second mutation, plsX, is required. J. Bacteriol. 160 711-7 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 CGSC: The Coli Genetics Stock Center
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
