{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	pgsA
Gene Synonym(s)	ECK1911, b1912, JW1897^[1], JW1897
Product Desc.	Phosphatidylglycerophosphate synthase^[2]
Product Synonyms(s)	phosphatidylglycerophosphate synthetase^[1], B1912^[3]^[1], PgsA^[3]^[1] , ECK1911, JW1897, b1912
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): pgsA^[3]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Overexpression causes filamentous biofilm formation.^[2]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	pgsA
Mnemonic	Phosphotidylglycerophosphate synthase
Synonyms	ECK1911, b1912, JW1897^[1], JW1897
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	42.9 minutes	MG1655: 1990841..1990293 <gbrowseImage> name=NC_000913:1990293..1990841 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 1970810..1970262 <gbrowseImage> name=NC_012967:1970262..1970810 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 1882776..1883324 <gbrowseImage> name=NC_012759:1882776..1883324 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 1994954..1994406 <gbrowseImage> name=NC_007779:1994406..1994954 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 2081849..2081301 <gbrowseImage> name=NC_010473:2081301..2081849 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
pgsA444						CGSC:9060
pgsA10		T92I		reduced levels of phosphatidylglycerol and cardiolipin	PMID:8195097	CGSC:9045	decreased enzyme activity parent strain: Hfr Cavalli man-1 pps (JE5512)
pgsA3		T60P^[4]	Growth Phenotype	expresses higher levels of micF RNA and reduced levels of OmpF	PMID:11601842
pgsA30::kan	Insertion of kan cassette		Growth Phenotype	lethal	PMID:7846051		The mutant allele can be maintained in a strain where pgsA+ is expressed from a plasmid. parent strain: MG1655
pgsA30::kan rnhA1::Tn3			Pseudorevertant	Inactivation of Rnase H suppresses the lethality of the pgsA loss-of-function allele.	PMID:7846051		parent strain: MG1655
pgsA3		T60P^[4]	Growth Phenotype	reduced levels of phosphatidylglycerol and cardiolipin	PMID:8195097		mutation reduces activity of the enzyme
pgsA30::kan lpp-2			Growth Phenotype	Cells lyse when shifted from 30°C to 40 or 42°C	PMID:10629182		parent strain: W3110
pgsA30::kan lpp-2			Growth Phenotype	No growth in minimal medium or low osmolarity medium.	PMID:10629182		parent strain: W3110
edit table

Notes

Growth arrest in a pgsA mutant is thought to be due to the role of anionic lipids in promoting reactivation of DnaA^[5]. Consistent with this, growth arrest is suppressed by situations where replication becomes DnaA-independent, e.g. rnhA mutants.

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW1897	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCCAATTTAATATCCCTACGTT Primer 2:CCtTGATCAAGCAAATCTGCACG
18A9	Kohara Phage	Genobase	PMID:3038334
16B12	Kohara Phage	Genobase	PMID:3038334
eda-51::Tn10	Linked marker	CAG18486 = CGSC7392^[6]	est. P1 cotransduction: 4% ^[7]
uvrC279::Tn10	Linked marker	CAG12156 = CGSC7394^[6]	est. P1 cotransduction: 100% ^[7]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10706	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10706	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000698	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945791	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0700	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0006367	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	PgsA
Synonyms	phosphatidylglycerophosphate synthetase^[1], B1912^[3]^[1], PgsA^[3]^[1] , ECK1911, JW1897, b1912
Product description	Phosphatidylglycerophosphate synthase^[2]
EC number (for enzymes)	2.7.8.5^[1]
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005886	plasma membrane	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01437	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0997	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0008444	CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01437	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008444	CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR004570	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008444	CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity	PMID:3003065	IDA: Inferred from Direct Assay		F	Assayed activity of purified protein.	complete
	GO:0008654	phospholipid biosynthetic process	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01437	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008654	phospholipid biosynthetic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000462	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008654	phospholipid biosynthetic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR004570	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008654	phospholipid biosynthetic process	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0594	P	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000462	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0472	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR004570	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0812	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-9909	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016740	transferase activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0808	F	Seeded from EcoCyc (v14.0)	complete
	GO:0016780	phosphotransferase activity, for other substituted phosphate groups	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000462	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008444	CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity	GOA:spec GO_REF:0000003	IEA: Inferred from Electronic Annotation	EC:2.7.8.5	F	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	PMID:3003065	IDA: Inferred from Direct Assay		C		complete
	GO:0005887	integral to plasma membrane	PMID:11152613	ISM: Inferred from Sequence Model	PMID:11152613	C		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source
plasma membrane	C-terminus localized in the cytoplasm with 4 predicted transmembrane domains	Daley et al. (2005) ^[8]
plasma membrane			From EcoCyc^[9]
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MQFNIPTLLT LFRVILIPFF VLVFYLPVTW SPFAAALIFC VAAVTDWFDG FLARRWNQST RFGAFLDPVA DKVLVAIAMV LVTEHYHSWW VTLPAATMIA REIIISALRE WMAELGKRSS VAVSWIGKVK TTAQMVALAW LLWRPNIWVE YAGIALFFVA AVLTLWSMLQ YLSAARADLL DQ
Length	182
Mol. Wt	20.7 kDa
pI	9.0 (calculated)
Extinction coefficient	66,460 - 66,585 (calc based on 4 Y, 11 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed (Probable)	UniProt:P0ABF8
Domain	2..158	PF01066 CDP-alcohol phosphatidyltransferase		PMID:19920124
edit table

<motif_map/>

Click the image to view raw output from TMHMM.

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=pgsA taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16129859	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945791	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0006367	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0ABF8	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10706	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10706	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945791	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000698	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0700	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	Ecoli K-12	25.135+/-0.261	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.028284672	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	736	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	396	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	321	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
pgsA
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:1990821..1990861 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b1912 (EcoliWiki Page)	NCBI GEO profiles for pgsA
microarray	GenExpDB:b1912 (EcoliWiki Page)	Summary of data for pgsA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (1990748..1990943) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ09; Well:A4^[10]
edit table

Notes

Accessions Related to pgsA Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10706	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0700	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b1912
EcoGene	EcoGene:EG10706	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000698	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0006367	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000010308 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000016975 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Arabidopsis thaliana	AT3G55030 (score: 1.000; bootstrap: 100%) AT2G39290 (score: 0.646)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000000072 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00035496 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00017763 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000008901 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Ciona intestinalis	ENSCINP00000005636 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-040426-2519 (score: 1.000; bootstrap: 100%) ZDB-CDNA-040425-3466 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila pseudoobscura	GA18422-PA (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Homo sapiens	ENSP00000202507 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000004754 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Mus musculus	MGI:1913836 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000022691 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000028900 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Saccharomyces cerevisiae	YDL142C (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPAC22A128c (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000177846 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00018740001 (score: 1.000; bootstrap: 57%)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000009415 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	PGSA	From SHIGELLACYC
E. coli O157	PGSA	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF01066 CDP-alcohol phosphatidyltransferase
Panther (EcoliWiki Page)	PTHR14269:SF3
EcoCyc	EcoCyc:EG10706	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10706	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000698	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0700	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0006367	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 Usui, M et al. (1994) Primary structures of the wild-type and mutant alleles encoding the phosphatidylglycerophosphate synthase of Escherichia coli. J. Bacteriol. 176 3389-92 PubMed
↑ Xia, W & Dowhan, W (1995) In vivo evidence for the involvement of anionic phospholipids in initiation of DNA replication in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 92 783-7 PubMed
↑ ^6.0 ^6.1 CGSC: The Coli Genetics Stock Center
↑ ^7.0 ^7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
↑ EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

pgsA:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to pgsA Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search