pgsA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
pgsA |
|---|---|
| Mnemonic |
Phosphotidylglycerophosphate synthase |
| Synonyms |
ECK1911, b1912, JW1897[1], JW1897 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
42.9 minutes |
MG1655: 1990841..1990293 |
||
|
NC_012967: 1970810..1970262 |
||||
|
NC_012759: 1882776..1883324 |
||||
|
W3110 |
|
W3110: 1994954..1994406 |
||
|
DH10B: 2081849..2081301 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
pgsA444 |
|||||||
|
pgsA10 |
T92I |
reduced levels of phosphatidylglycerol and cardiolipin |
decreased enzyme activity parent strain: Hfr Cavalli man-1 pps (JE5512) | ||||
|
pgsA3 |
T60P[2] |
Growth Phenotype |
expresses higher levels of micF RNA and reduced levels of OmpF |
||||
|
pgsA30::kan |
Insertion of kan cassette |
Growth Phenotype |
lethal |
The mutant allele can be maintained in a strain where pgsA+ is expressed from a plasmid. parent strain: MG1655 | |||
|
pgsA30::kan rnhA1::Tn3 |
Pseudorevertant |
Inactivation of Rnase H suppresses the lethality of the pgsA loss-of-function allele. |
parent strain: MG1655 | ||||
|
pgsA3 |
T60P[2] |
Growth Phenotype |
reduced levels of phosphatidylglycerol and cardiolipin |
mutation reduces activity of the enzyme | |||
|
pgsA30::kan lpp-2 |
Growth Phenotype |
Cells lyse when shifted from 30°C to 40 or 42°C |
parent strain: W3110 | ||||
|
pgsA30::kan lpp-2 |
Growth Phenotype |
No growth in minimal medium or low osmolarity medium. |
parent strain: W3110 | ||||
| edit table |
<protect></protect>
Notes
Growth arrest in a pgsA mutant is thought to be due to the role of anionic lipids in promoting reactivation of DnaA[4]. Consistent with this, growth arrest is suppressed by situations where replication becomes DnaA-independent, e.g. rnhA mutants.
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1897 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCAATTTAATATCCCTACGTT Primer 2:CCtTGATCAAGCAAATCTGCACG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 4% [9] | ||
|
Linked marker |
est. P1 cotransduction: 100% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 Usui, M et al. (1994) Primary structures of the wild-type and mutant alleles encoding the phosphatidylglycerophosphate synthase of Escherichia coli. J. Bacteriol. 176 3389-92 PubMed
- ↑ Delihas, N & Forst, S (2001) MicF: an antisense RNA gene involved in response of Escherichia coli to global stress factors. J. Mol. Biol. 313 1-12 PubMed
- ↑ 4.0 4.1 4.2 Xia, W & Dowhan, W (1995) In vivo evidence for the involvement of anionic phospholipids in initiation of DNA replication in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 92 783-7 PubMed
- ↑ 5.0 5.1 Kikuchi, S et al. (2000) Viability of an Escherichia coli pgsA null mutant lacking detectable phosphatidylglycerol and cardiolipin. J. Bacteriol. 182 371-6 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).