oppA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
oppA |
|---|---|
| Mnemonic |
Oligopeptide permease |
| Synonyms |
ECK1237, b1243, JW1235[1], JW1235 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links | |
|---|---|---|---|---|---|
|
MG1655 |
28 minutes |
MG1655: 1299206..1300837 |
|||
|
NC_012967: 1298776..1300407 |
|||||
|
NC_012759: 1188704..1190335 |
|||||
|
W3110 |
|
W3110: 1302896..1304527 |
|||
|
DH10B: 1340224..1341855 |
|||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1299284 |
Edman degradation |
PMID:2187863[2] |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Strain DH10B |
N271Y |
Nonsynonomous mutation |
This is a SNP in E. coli K-12 Strain DH10B | ||||
|
oppA(del) (Keio:JW1235) |
deletion |
deletion |
|||||
|
oppA::Tn5KAN-2 (FB20273) |
Insertion at nt 950 in Plus orientation |
does not contain pKD46 | |||||
|
oppA750(del)::kan |
|||||||
|
oppA |
Resistant to |
Resistant to Alanyl-2-aminopropionate |
|||||
|
oppA in strain PA0112 |
Resistant to |
Resistant to Alanyl-2-aminopropionate |
Strain PA0112 |
||||
|
oppA |
Resistant to |
Resistant to triornithine |
Author Statement in page 833 | ||||
|
oppA |
Resistant to |
Resistant to trlysine |
Author Statement in page 833 | ||||
|
oppA |
Resistant to |
Resistant to norleucyglycylglycine |
Author Statement in page 833 | ||||
|
oppA |
Resistant to |
Resistant to toxic peptide glycylglycyl-histidinol phosphate ester |
Author Statement in page 833 | ||||
|
oppA - |
Resistant to |
Resistant to Phaseolotixon |
Strain: PM786, |
Table 2. Other strains with same phenotype are described. | |||
|
oppA - |
Resistant to |
Resistant to Triornithine |
Strain: PM786 |
Table 2. Other strains with same phenotype are described. | |||
|
oppA |
Resistant to |
Resistant to tripeptide |
table 1 | ||||
|
oppA |
Resistant to |
Resistant to glycylglycyl-N-S-(phosphonoacetyl)-L-ornithine |
| ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1235 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACCAACATCACCAAGAGAAG Primer 2:CCGTGCTTCACAATGTACATATT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 3% [18] | ||
|
Linked marker |
est. P1 cotransduction: 86% [18] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kashiwagi, K et al. (1990) Identification of the polyamine-induced protein as a periplasmic oligopeptide binding protein. J. Biol. Chem. 265 8387-91 PubMed
- ↑ Pasquali, C et al. (1996) Two-dimensional gel electrophoresis of Escherichia coli homogenates: the Escherichia coli SWISS-2DPAGE database. Electrophoresis 17 547-55 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed
- ↑ Tonella, L et al. (1998) '98 Escherichia coli SWISS-2DPAGE database update. Electrophoresis 19 1960-71 PubMed
- ↑ Urbanowski, ML et al. (2000) The gcvB gene encodes a small untranslated RNA involved in expression of the dipeptide and oligopeptide transport systems in Escherichia coli. Mol. Microbiol. 37 856-68 PubMed
- ↑ Durfee, T et al. (2008) The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J. Bacteriol. 190 2597-606 PubMed
- ↑ 9.0 9.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 10.0 10.1 10.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 12.0 12.1 Payne, JW et al. (1984) Transport and hydrolysis of antibacterial peptide analogues in Escherichia coli: backbone-modified aminoxy peptides. J. Gen. Microbiol. 130 2253-65 PubMed
- ↑ 13.0 13.1 13.2 13.3 Higgins, CF et al. (1983) Genetic map of the opp (Oligopeptide permease) locus of Salmonella typhimurium. J. Bacteriol. 153 830-6 PubMed
- ↑ 14.0 14.1 Staskawicz, BJ & Panopoulos, NJ (1980) Phaseolotoxin transport in Escherichia coli and Salmonella typhimurium via the oligopeptide permease. J. Bacteriol. 142 474-9 PubMed
- ↑ 15.0 15.1 Penninckx, M & Gigot, D (1979) Synthesis of a peptide form of N-delta-(phosphonoacetyl)-L-ornithine. Its antibacterial effect through the specific inhibition of Escherichia coli L-ornithine carbamoyltransferase. J. Biol. Chem. 254 6392-6 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 17.0 17.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 18.0 18.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
