ompT:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
ompT |
|---|---|
| Gene Synonym(s) |
ECK0557, b0565, JW0554[1], JW0554 |
| Product Desc. |
outer membrane protein 3b (a), protease VII[2]; outer membrane protease VII (outer membrane protein 3b)[3] Outer membrane protease VII, DLP12 prophage; OM protein 2b; omptin[4] |
| Product Synonyms(s) |
DLP12 prophage; outer membrane protease VII (outer membrane protein 3b)[1], B0565[2][1], OmpT[2][1], protease VII[2][1], omptin[2][1] , ECK0557, JW0554, b0565 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Mg(2+) stimulon-PhoPQ regulon, EvgAS-PhoPQ cascade enhanced-expression subset.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ompT |
|---|---|
| Mnemonic |
Outer membrane protein |
| Synonyms |
ECK0557, b0565, JW0554[1], JW0554 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
12.58 minutes |
MG1655: 584856..583903 |
||
|
NC_012967: 560984..560031 |
||||
|
NC_012759: 486663..487616 |
||||
|
W3110 |
|
W3110: 584856..583903 |
||
|
DH10B: 524188..523235 |
||||
|
DH10B: 637448..636495 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
583906 |
Edman degradation |
PMID:3056908 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔompT (Keio:JW0554) |
deletion |
deletion |
PMID:16738554 |
||||
|
ompTD103A |
D103A |
Loss of activity |
seeded from UniProt:P09169 | ||||
|
ompTD105A |
D105A |
Loss of activity |
seeded from UniProt:P09169 | ||||
|
ompTD230A |
D230A |
Loss of activity |
seeded from UniProt:P09169 | ||||
|
ompTGK236KG |
GK236KG |
70% of wild-type enzymatic activity |
seeded from UniProt:P09169 | ||||
|
ompTK237T |
K237T |
40% of wild-type enzymatic activity |
seeded from UniProt:P09169 | ||||
|
ompTR238L |
R238L |
Loss of activity |
seeded from UniProt:P09169 | ||||
|
ΔompT |
deletion |
deletion |
lack ompT protease activity. lack the ability to cleave between specific paired basic amino acids |
PMID: 17880914 |
|||
|
ΔompT504 |
|||||||
|
ompT1000::kan |
|||||||
|
ΔompT774::kan |
PMID:16738554 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0554 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCCGGGCGAAACTTCTGGGAAT Primer 2:CCAAATGTGTACTTAAGACCAGC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 28% [6] | ||
|
Linked marker |
est. P1 cotransduction: 9% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10673 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10673 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000666 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0667 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0001931 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
OmpT |
|---|---|
| Synonyms |
DLP12 prophage; outer membrane protease VII (outer membrane protein 3b)[1], B0565[2][1], OmpT[2][1], protease VII[2][1], omptin[2][1] , ECK0557, JW0554, b0565 |
| Product description |
outer membrane protein 3b (a), protease VII[2]; outer membrane protease VII (outer membrane protein 3b)[3] Outer membrane protease VII, DLP12 prophage; OM protein 2b; omptin[4] |
| EC number (for enzymes) | |
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0031230 |
intrinsic to cell outer membrane |
C |
Seeded from Riley et al 2006 [1]. |
Missing: evidence, reference | ||||
|
GO:0004175 |
endopeptidase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000036 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004175 |
endopeptidase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR020079 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004190 |
aspartic-type endopeptidase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0064 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006508 |
proteolysis |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000036 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006508 |
proteolysis |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR020079 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0008233 |
peptidase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0645 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0009279 |
cell outer membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000036 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0009279 |
cell outer membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR020079 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0009279 |
cell outer membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0998 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0812 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9909 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016787 |
hydrolase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0378 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0031230 |
intrinsic to cell outer membrane |
PMID:6337119 |
IDA: Inferred from Direct Assay |
C |
complete | |||
|
GO:0004175 |
endopeptidase activity |
PMID:3277950 |
IMP: Inferred from Mutant Phenotype |
F |
complete | |||
|
GO:0006508 |
proteolysis |
PMID:3277950 |
IMP: Inferred from Mutant Phenotype |
P |
complete | |||
|
GO:0031230 |
intrinsic to cell outer membrane |
PMID:10692590 |
IDA: Inferred from Direct Assay |
C |
complete | |||
|
GO:0004252 |
serine-type endopeptidase activity |
PMID:10692590 |
IMP: Inferred from Mutant Phenotype |
F |
complete | |||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes | |
|---|---|---|---|---|---|
|
outer membrane |
|||||
|
Outer Membrane |
PMID:9298646 |
| |||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MRAKLLGIVL TTPIAISSFA STETLSFTPD NINADISLGT LSGKTKERVY LAEEGGRKVS QLDWKFNNAA IIKGAINWDL MPQISIGAAG WTTLGSRGGN MVDQDWMDSS NPGTWTDESR HPDTQLNYAN EFDLNIKGWL LNEPNYRLGL MAGYQESRYS FTARGGSYIY SSEEGFRDDI GSFPNGERAI GYKQRFKMPY IGLTGSYRYE DFELGGTFKY SGWVESSDND EHYDPGKRIT YRSKVKDQNY YSVAVNAGYY VTPNAKVYVE GAWNRVTNKK GNTSLYDHNN NTSDYSKNGA GIENYNFITT AGLKYTF |
| Length |
317 |
| Mol. Wt |
35.563 kDa |
| pI |
5.8 (calculated) |
| Extinction coefficient |
78,270 (calc based on 23 Y, 8 W, and 0 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0001931 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10673 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10673 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000666 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0667 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
2.59E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
40237 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
24644 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
32467 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:584836..584876
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for ompT | |
|
microarray |
Summary of data for ompT from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (584578..585222) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to ompT Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10673 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0667 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10673 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000666 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0001931 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
<protect>
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
| edit table |
</protect>
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10673 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10673 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000666 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0667 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0001931 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories


