ompT:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ompT |
|---|---|
| Mnemonic |
Outer membrane protein |
| Synonyms |
ECK0557, b0565, JW0554[1], JW0554 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
12.58 minutes |
MG1655: 584856..583903 |
||
|
NC_012967: 560984..560031 |
||||
|
NC_012759: 486663..487616 |
||||
|
W3110 |
|
W3110: 584856..583903 |
||
|
DH10B: 524188..523235 |
||||
|
DH10B: 637448..636495 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
583906 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔompT (Keio:JW0554) |
deletion |
deletion |
|||||
|
ompTD103A |
D103A |
Loss of activity |
seeded from UniProt:P09169 | ||||
|
ompTD105A |
D105A |
Loss of activity |
seeded from UniProt:P09169 | ||||
|
ompTD230A |
D230A |
Loss of activity |
seeded from UniProt:P09169 | ||||
|
ompTGK236KG |
GK236KG |
70% of wild-type enzymatic activity |
seeded from UniProt:P09169 | ||||
|
ompTK237T |
K237T |
40% of wild-type enzymatic activity |
seeded from UniProt:P09169 | ||||
|
ompTR238L |
R238L |
Loss of activity |
seeded from UniProt:P09169 | ||||
|
ΔompT |
deletion |
deletion |
lack ompT protease activity. lack the ability to cleave between specific paired basic amino acids |
||||
|
ΔompT504 |
|||||||
|
ompT1000::kan |
|||||||
|
ΔompT774::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0554 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCGGGCGAAACTTCTGGGAAT Primer 2:CCAAATGTGTACTTAAGACCAGC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 28% [10] | ||
|
Linked marker |
est. P1 cotransduction: 9% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Sugimura, K & Nishihara, T (1988) Purification, characterization, and primary structure of Escherichia coli protease VII with specificity for paired basic residues: identity of protease VII and OmpT. J. Bacteriol. 170 5625-32 PubMed
- ↑ Grodberg, J et al. (1988) Complete nucleotide sequence and deduced amino acid sequence of the ompT gene of Escherichia coli K-12. Nucleic Acids Res. 16 1209 PubMed
- ↑ Molloy, MP et al. (1998) Extraction of membrane proteins by differential solubilization for separation using two-dimensional gel electrophoresis. Electrophoresis 19 837-44 PubMed
- ↑ 5.0 5.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
- ↑ Bishop, RE (2008) Structural biology of membrane-intrinsic beta-barrel enzymes: sentinels of the bacterial outer membrane. Biochim. Biophys. Acta 1778 1881-96 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 9.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).