{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	ompF
Gene Synonym(s)	ECK0920, b0929, JW0912, cmlB, coa, cry, tolF, nfxB?^[1]^[2], nfxB?
Product Desc.	outer membrane porin OmpF^[2]; OmpF^[3]; Component of outer membrane porin F^[3]; The Colicin A Import System^[3] Outer membrane porin F^[4]
Product Synonyms(s)	outer membrane porin 1a (Ia;b;F)^[1], B0929^[2]^[1], TolF^[2]^[1], Cry^[2]^[1], Coa^[2]^[1], CmlB^[2]^[1], OmpF^[2]^[1], outer membrane porin OmpF^[3]^[1] , cmlB, coa, cry, ECK0920, JW0912, nfxB?, tolF, b0929
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): ompF^[2], OP00066
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Trimeric. T2 receptor. Colicin N receptor and translocator. Translation of OmpF is inhibited by the rseX sRNA. Binds TrxA (Kumar, 2004).^[4]

Reduced levels of OmpF give multiple antibiotic resistance ^[5]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	ompF
Mnemonic	Outer membrane protein
Synonyms	ECK0920, b0929, JW0912, cmlB, coa, cry, tolF, nfxB?^[1]^[2], nfxB?
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	21.23 minutes	MG1655: 986205..985117 <gbrowseImage> name=NC_000913:985117..986205 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 1004074..1002986 <gbrowseImage> name=NC_012967:1002986..1004074 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 888085..889173 <gbrowseImage> name=NC_012759:888085..889173 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 987404..986316 <gbrowseImage> name=NC_007779:986316..987404 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 1040133..1039045 <gbrowseImage> name=NC_010473:1039045..1040133 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	985120	Edman degradation	PMID:7001461 PMID:9298646 PMID:9629924
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
ompF(del) (Keio:JW0912)	deletion	deletion			PMID:16738554	Shigen CGSC8925^[6]
ompF627(T2R)				T2 resistant	PMID:3286621	CGSC:4722
ompF626						CGSC:6264
ompF254						CGSC:6819
ompF625						CGSC:11640
ompF746(del)::kan					PMID:16738554	CGSC:102178
ompFp9			protein expression	OmpF is constitutively expressed in ompFp9 mutants, there is less repression than in wild-type strain	PMID:7007334
ompF^-			Resistant to	Resistance to Cloacin DF13	PMID:2013565	Strain: LG1702	Figure 3
ompF in strain JF557			Resistant to	Resistance to Polymyxin	PMID:789358	Strain: JF557	TABLE 5
ompF in strain JF557			Resistant to	Resistance to Colicin A	PMID:789358	Strain: JF557	TABLE 5
ompF in strain JF557			Resistant to	Resistance to Colicin E2	PMID:789358	Strain: JF557	TABLE 5
ompF in strain JF557			Resistant to	Resistance to Colicin E3	PMID:789358	Strain: JF557	TABLE 5
ompF in strain JF557			Resistant to	Resistance to Colicin E3	PMID:789358	Strain: JF557	TABLE 5
ompF in strain JF557			Resistant to	Resistance to Colicin K	PMID:789358	Strain: JF557	TABLE 5
ompF in strain JF557			Resistant to	Resistance to Colicin K	PMID:789358	Strain: JF557	TABLE 5
ompF in strain JF557			Resistant to	Resistance to Colicin L	PMID:789358	Strain: JF557	TABLE 5
ompF in strain JF557			Resistant to	Resistance to Colicin L-JF246	PMID:789358	Strain: JF557	TABLE 5
ompF in strain JF557			Resistant to	Resistance to Chloramphenicol	PMID:789358	Strain: JF557	TABLE 5
ompF in strain JF557			Resistant to	Resistance to tetracycline	PMID:789358	Strain: JF557	TABLE 5
ompF in strain JF557			Resistant to	Resistance to Oxytetracycline	PMID:789358	Strain: JF557	TABLE 5
ompF1466			Resistant to	Resistance to beta lactam ampicillin	PMID:6760806	Strains B1466, B1449 (ompF::Tn5), B1477 (tpo-1454), pop1387('tpo-11)	Mutant is characterized by lack of ompF in strain B1466. Please see table 3.
ompF1466			Resistant to	Resistance to beta lactam cefoxitin	PMID:6760806	Strains B1466, B1449 (ompF::Tn5), B1477 (tpo-1454), pop1387('tpo-11)	Mutant is characterized by lack of ompF in strain B1466. Please see table 3.
tolF in mutant strain JF557			Resistant to	Resistant to Tetracycline	PMID:789358	Strain: JF557	Table 5
tolF in mutant strain JF557			Resistant to	Resistant to Chloramphenicol	PMID:789358	Strain: JF557	Table 5
ompF in strain JF703			Resistant to	Resistance to Colicin A	PMID:7047502	Strain: JF703	table 2
ompF^-			Resistant to	Introduction of ompF mutation caused a partial resistance to Microcin B17.	PMID:3543211		See table 4 for complete experimental results.
ompF^- recA^-			Resistant to	Introduction of double mutation caused an increase in resistance to Microcin B17.	PMID:3543211		See table 4 for complete experimental results.
cmlB5			Resistant to	Resistant to choramphenicol as measured by zones of growth inhibition.	PMID:374348	Parental Strain: RE1 CGSC Experimental Strain: RE107 CGSC	Growth Inhibition experiments Figure 2
ompF in mutant strain CE1121			Resistant to	Resistant to TuIa phage.	PMID:375003	Experimental Strain: CE1121 Parental Strain: PC0479
ompF627 fadL701			Resistant to	Resistance to phage T2	PMID:3286621	Experimental Strain: E15
edit table

Notes

Reduced levels of OmpF gives multiple antibiotic resistance. ^[5]

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0912	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCATGAAGCGCAATATTCTGGC Primer 2:CCGAACTGGTAAACGATACCCAC
E1D1	Kohara Phage	Genobase	PMID:3038334
11F5	Kohara Phage	Genobase	PMID:3038334
zca-1230::Tn10	Linked marker	CAG18478 = CGSC7356^[6]	est. P1 cotransduction: 20% ^[7] Synonyms:zbj-1230::Tn10
zcb-3059::Tn10	Linked marker	CAG12094 = CGSC7358^[6]	est. P1 cotransduction: 54% ^[7]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10671	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10671	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000664	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945554	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0665	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003153	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	OmpF
Synonyms	outer membrane porin 1a (Ia;b;F)^[1], B0929^[2]^[1], TolF^[2]^[1], Cry^[2]^[1], Coa^[2]^[1], CmlB^[2]^[1], OmpF^[2]^[1], outer membrane porin OmpF^[3]^[1] , cmlB, coa, cry, ECK0920, JW0912, nfxB?, tolF, b0929
Product description	outer membrane porin OmpF^[2]; OmpF^[3]; Component of outer membrane porin F^[3]; The Colicin A Import System^[3] Outer membrane porin F^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005215	transporter activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001702	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005215	transporter activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001897	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001702	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001897	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0813	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006811	ion transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0406	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009279	cell outer membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0998	C	Seeded from EcoCyc (v14.0)	complete
	GO:0009597	detection of virus	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0580	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015288	porin activity	PMID:8702817	IMP: Inferred from Mutant Phenotype		F		complete
	GO:0016020	membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001702	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001897	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0472	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0812	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-9909	C	Seeded from EcoCyc (v14.0)	complete
	GO:0046718	entry of virus into host cell	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0580	P	Seeded from EcoCyc (v14.0)	complete
	GO:0046930	pore complex	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0626	C	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References
Protein	Subunits of outer membrane porin F	could be indirect
Protein	Subunits of The Colicin A Import System	could be indirect
Protein	OmpC	OmpC synthesis depends on ompF gene expression	PMID:6302079
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Evidence	Reference/Source
outer membrane		From EcoCyc^[3]
Outer Membrane	PMID:9298646	EchoLocation:ompF
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MMKRNILAVI VPALLVAGTA NAAEIYNKDG NKVDLYGKAV GLHYFSKGNG ENSYGGNGDM TYARLGFKGE TQINSDLTGY GQWEYNFQGN NSEGADAQTG NKTRLAFAGL KYADVGSFDY GRNYGVVYDA LGYTDMLPEF GGDTAYSDDF FVGRVGGVAT YRNSNFFGLV DGLNFAVQYL GKNERDTARR SNGDGVGGSI SYEYEGFGIV GAYGAADRTN LQEAQPLGNG KKAEQWATGL KYDANNIYLA ANYGETRNAT PITNKFTNTS GFANKTQDVL LVAQYQFDFG LRPSIAYTKS KAKDVEGIGD VDLVNYFEVG ATYYFNKNMS TYVDYIINQI DSDNKLGVGS DDTVAVGIVY QF
Length	362
Mol. Wt	39.333 kDa
pI	4.6 (calculated)
Extinction coefficient	54,210 (calc based on 29 Y, 2 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
motif	1-22	UniProt Manual:Signal Peptides	UniProt:P02931
Domain	28..362	PF00267 Gram-negative porin		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=ompF taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16128896	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945554	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003153	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P02931	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10671	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10671	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945554	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000664	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0665	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	1.25E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	E. coli K-12 EMG2	1980	molecules/cell	Medium: MOPS glucose minimal Temperature (°C): 37 Doubling time (min): Growth phase: Exponential OD: OD600 = 0.2 to 0.25 other: aerated	Quantitative protein sequencing	Spot ID: M25	PMID: 9298646
Protein	E. coli K-12 EMG2	2160	molecules/cell	Medium: MOPS glucose minimal Temperature (°C): 37 Doubling time (min): Growth phase: Exponential OD: OD600 = 0.2 to 0.25 other: aerated	Quantitative protein sequencing	Spot ID: M51	PMID: 9298646
Protein	E. coli K-12 EMG2	17600	molecules/cell	Medium: MOPS glucose minimal Temperature (°C): 37 Doubling time (min): Growth phase: Exponential OD: OD600 = 0.2 to 0.25 other: aerated	Quantitative protein sequencing	Spot ID: Ml54	PMID: 9298646
Protein	E. coli K-12 MG1655	88988	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	71798	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	63340	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
ompF
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

There is a pleiotropic decrease in expression of ompF with the addition of procaine. ^[8]

High concentrations of sucrose decreases the amount of OmpF protein and regulates ompF gene expression. ^[9]

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:986185..986225 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0929 (EcoliWiki Page)	NCBI GEO profiles for ompF
microarray	GenExpDB:b0929 (EcoliWiki Page)	Summary of data for ompF from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to ompF Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10671	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0665	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0929
EcoGene	EcoGene:EG10671	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000664	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003153	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	OMPF	From SHIGELLACYC
E. coli O157	OMPF	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00267 Gram-negative porin
Superfamily (EcoliWiki Page)	SUPERFAMILY:56935
EcoCyc	EcoCyc:EG10671	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10671	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000664	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0665	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003153	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 ^1.13 ^1.14 ^1.15 ^1.16 ^1.17 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 ^2.13 ^2.14 ^2.15 ^2.16 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 ^3.5 ^3.6 ^3.7 ^3.8 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 Delihas, N & Forst, S (2001) MicF: an antisense RNA gene involved in response of Escherichia coli to global stress factors. J. Mol. Biol. 313 1-12 PubMed
↑ ^6.0 ^6.1 ^6.2 CGSC: The Coli Genetics Stock Center
↑ ^7.0 ^7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Garrett, S et al. (1983) Isolation and characterization of chain-terminating nonsense mutations in a porin regulator gene, envZ. J. Bacteriol. 156 62-9 PubMed
↑ Ozawa, Y & Mizushima, S (1983) Regulation of outer membrane porin protein synthesis in Escherichia coli K-12: ompF regulates the expression of ompC. J. Bacteriol. 154 669-75 PubMed

ompF:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to ompF Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search