ompF:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ompF |
|---|---|
| Mnemonic |
Outer membrane protein |
| Synonyms |
ECK0920, b0929, JW0912, cmlB, coa, cry, tolF, nfxB?[1][2], nfxB? |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
21.23 minutes |
MG1655: 986205..985117 |
||
|
NC_012967: 1004074..1002986 |
||||
|
NC_012759: 888085..889173 |
||||
|
W3110 |
|
W3110: 987404..986316 |
||
|
DH10B: 1040133..1039045 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
985120 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ompF(del) (Keio:JW0912) |
deletion |
deletion |
|||||
|
ompF627(T2R) |
T2 resistant |
||||||
|
ompF626 |
|||||||
|
ompF254 |
|||||||
|
ompF625 |
|||||||
|
ompF746(del)::kan |
|||||||
|
ompFp9 |
protein expression |
OmpF is constitutively expressed in ompFp9 mutants, there is less repression than in wild-type strain |
|||||
|
ompF - |
Resistant to |
Resistance to Cloacin DF13 |
Strain: LG1702 |
Figure 3 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to Polymyxin |
Strain: JF557 |
TABLE 5 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to Colicin A |
Strain: JF557 |
TABLE 5 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to Colicin E2 |
Strain: JF557 |
TABLE 5 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to Colicin E3 |
Strain: JF557 |
TABLE 5 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to Colicin E3 |
Strain: JF557 |
TABLE 5 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to Colicin K |
Strain: JF557 |
TABLE 5 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to Colicin K |
Strain: JF557 |
TABLE 5 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to Colicin L |
Strain: JF557 |
TABLE 5 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to Colicin L-JF246 |
Strain: JF557 |
TABLE 5 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to Chloramphenicol |
Strain: JF557 |
TABLE 5 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to tetracycline |
Strain: JF557 |
TABLE 5 | |||
|
ompF in strain JF557 |
Resistant to |
Resistance to Oxytetracycline |
Strain: JF557 |
TABLE 5 | |||
|
ompF1466 |
Resistant to |
Resistance to beta lactam ampicillin |
Strains B1466, B1449 (ompF::Tn5), B1477 (tpo-1454), pop1387('tpo-11) |
Mutant is characterized by lack of ompF in strain B1466. Please see table 3. | |||
|
ompF1466 |
Resistant to |
Resistance to beta lactam cefoxitin |
Strains B1466, B1449 (ompF::Tn5), B1477 (tpo-1454), pop1387('tpo-11) |
Mutant is characterized by lack of ompF in strain B1466. Please see table 3. | |||
|
tolF in mutant strain JF557 |
Resistant to |
Resistant to Tetracycline |
Strain: JF557 |
Table 5 | |||
|
tolF in mutant strain JF557 |
Resistant to |
Resistant to Chloramphenicol |
Strain: JF557 |
Table 5 | |||
|
ompF in strain JF703 |
Resistant to |
Resistance to Colicin A |
Strain: JF703 |
table 2 | |||
|
ompF- |
Resistant to |
Introduction of ompF mutation caused a partial resistance to Microcin B17. |
See table 4 for complete experimental results. | ||||
|
ompF- recA- |
Resistant to |
Introduction of double mutation caused an increase in resistance to Microcin B17. |
See table 4 for complete experimental results. | ||||
|
cmlB5 |
Resistant to |
Resistant to choramphenicol as measured by zones of growth inhibition. |
Parental Strain: RE1 CGSC
|
Growth Inhibition experiments Figure 2 | |||
|
ompF in mutant strain CE1121 |
Resistant to |
Resistant to TuIa phage. |
Experimental Strain: CE1121 Parental Strain: PC0479 |
||||
|
ompF627 fadL701 |
Resistant to |
Resistance to phage T2 |
Experimental Strain: E15
|
| |||
| edit table |
<protect></protect>
Notes
Reduced levels of OmpF gives multiple antibiotic resistance. [17]
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0912 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATGAAGCGCAATATTCTGGC Primer 2:CCGAACTGGTAAACGATACCCAC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: 20% [20] | |
|
Linked marker |
est. P1 cotransduction: 54% [20] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Chen, R et al. (1980) Primary structure of major outer membrane protein II (ompA protein) of Escherichia coli K-12. Proc. Natl. Acad. Sci. U.S.A. 77 4592-6 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Molloy, MP et al. (1998) Extraction of membrane proteins by differential solubilization for separation using two-dimensional gel electrophoresis. Electrophoresis 19 837-44 PubMed
- ↑ 6.0 6.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 7.0 7.1 7.2 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 Black, PN (1988) The fadL gene product of Escherichia coli is an outer membrane protein required for uptake of long-chain fatty acids and involved in sensitivity to bacteriophage T2. J. Bacteriol. 170 2850-4 PubMed
- ↑ Sato, T & Yura, T (1981) Regulatory mutations conferring constitutive synthesis of major outer membrane proteins (OmpC and OmpF) in Escherichia coli. J. Bacteriol. 145 88-96 PubMed
- ↑ Wooldridge, KG & Williams, PH (1991) Sensitivity of Escherichia coli to cloacin DF13 involves the major outer membrane protein OmpF. J. Bacteriol. 173 2420-4 PubMed
- ↑ 11.00 11.01 11.02 11.03 11.04 11.05 11.06 11.07 11.08 11.09 11.10 11.11 11.12 11.13 Foulds, J (1976) TolF locus in Escherichia coli: chromosomal location and relationship to loci cmlB and tolD. J. Bacteriol. 128 604-8 PubMed
- ↑ 12.0 12.1 Jaffe, A et al. (1982) Role of porin proteins OmpF and OmpC in the permeation of beta-lactams. Antimicrob. Agents Chemother. 22 942-8 PubMed
- ↑ Chai, T et al. (1982) Colicin A receptor: role of two Escherichia coli outer membrane proteins (OmpF protein and btuB gene product) and lipopolysaccharide. J. Bacteriol. 151 983-8 PubMed
- ↑ 14.0 14.1 Laviña, M et al. (1986) Identification, mapping, cloning and characterization of a gene (sbmA) required for microcin B17 action on Escherichia coli K12. J. Gen. Microbiol. 132 1685-93 PubMed
- ↑ Baughman, GA & Fahnestock, SR (1979) Chloramphenicol resistance mutation in Escherichia coli which maps in the major ribosomal protein gene cluster. J. Bacteriol. 137 1315-23 PubMed
- ↑ Verhoef, C et al. (1979) Genetics and biochemistry of the peptidoglycan-associated proteins b and c of Escherichia coli K12. Mol. Gen. Genet. 169 137-46 PubMed
- ↑ Delihas, N & Forst, S (2001) MicF: an antisense RNA gene involved in response of Escherichia coli to global stress factors. J. Mol. Biol. 313 1-12 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 19.0 19.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 20.0 20.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
