nusG:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
nusG |
---|---|
Gene Synonym(s) |
ECK3973, b3982, JW3945[1], JW3945 |
Product Desc. |
transcription termination factor NusG[2][3] Stabilizes phage lambda protein N-NusA-RNAP antitermination complex[4] |
Product Synonyms(s) |
transcription termination factor[1], B3982[2][1], NusG[2][1] , ECK3973, JW3945, b3982 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Binds TrxA (Kumar, 2004).[4]
Binds Rho [5]
Required for Rho-dependent termination in vivo [6] and enhances Rho-dependent termination in vitro [7] [8] [9]
Maintains genomic integrity [10]
Essential in rac+ strains to prevent expression of toxic prophage gene kilR [11]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
nusG |
---|---|
Mnemonic |
N (phage lambda protein) utilization substance |
Synonyms |
ECK3973, b3982, JW3945[1], JW3945 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
90 minutes |
MG1655: 4175766..4176311 |
||
NC_012967: 4157354..4157899 |
||||
NC_012759: 4065446..4065991 |
||||
W3110 |
|
W3110: 3458938..3458393 |
||
DH10B: 4275462..4276007 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
4175769 |
Edman degradation |
PMID:9600841 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
MDS42 nusG(del) |
deletion |
Sensitivity to |
increases sensitivity to Bicyclomycin |
PMID:21183718 |
see Figure 2A | ||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW3945 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCTCTGAAGCTCCTAAAAAGCG Primer 2:CCGGCTTTTTCAACCTGGCTGAA | |
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 42% [13] | ||
Linked marker |
est. P1 cotransduction: 51% [13] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10667 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10667 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000660 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0661 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0013026 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
NusG |
---|---|
Synonyms |
transcription termination factor[1], B3982[2][1], NusG[2][1] , ECK3973, JW3945, b3982 |
Product description |
transcription termination factor NusG[2][3] Stabilizes phage lambda protein N-NusA-RNAP antitermination complex[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0003711 |
transcription elongation regulator activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001062 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003711 |
transcription elongation regulator activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006645 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006353 |
transcription termination |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0806 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001062 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0031564 |
transcription antitermination |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0889 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0032968 |
positive regulation of RNA elongation from RNA polymerase II promoter |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006645 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
macA |
PMID:15690043 |
Experiment(s):EBI-886705 | |
Protein |
arnA |
PMID:15690043 |
Experiment(s):EBI-886705 | |
Protein |
dnaJ |
PMID:15690043 |
Experiment(s):EBI-886705 | |
Protein |
rapA |
PMID:15690043 |
Experiment(s):EBI-886705 | |
Protein |
mreB |
PMID:15690043 |
Experiment(s):EBI-886705, EBI-893751 | |
Protein |
pssA |
PMID:15690043 |
Experiment(s):EBI-886705 | |
Protein |
rho |
PMID:15690043 |
Experiment(s):EBI-886705, EBI-891277, EBI-893067 | |
Protein |
rplB |
PMID:15690043 |
Experiment(s):EBI-886705 | |
Protein |
rplE |
PMID:15690043 |
Experiment(s):EBI-886705 | |
Protein |
rpoA |
PMID:15690043 |
Experiment(s):EBI-886705, EBI-879354, EBI-883271, EBI-893067 | |
Protein |
rpoB |
PMID:15690043 |
Experiment(s):EBI-886705, EBI-879304, EBI-883170 | |
Protein |
rpoC |
PMID:15690043 |
Experiment(s):EBI-886705, EBI-879261, EBI-883046 | |
Protein |
rpsC |
PMID:15690043 |
Experiment(s):EBI-886705 | |
Protein |
rpsE |
PMID:15690043 |
Experiment(s):EBI-886705, EBI-893067 | |
Protein |
rpsJ |
PMID:15690043 |
Experiment(s):EBI-886705, EBI-893067 | |
Protein |
secA |
PMID:15690043 |
Experiment(s):EBI-886705 | |
Protein |
sgbH |
PMID:15690043 |
Experiment(s):EBI-886705 | |
Protein |
yacL |
PMID:15690043 |
Experiment(s):EBI-886705, EBI-879082, EBI-882523, EBI-893067 | |
Protein |
deaD |
PMID:15690043 |
Experiment(s):EBI-886705 | |
Protein |
rpoA |
PMID:16606699 |
Experiment(s):EBI-1147147 | |
Protein |
rpoC |
PMID:16606699 |
Experiment(s):EBI-1147147 | |
Protein |
iscS |
PMID:16606699 |
Experiment(s):EBI-1147147 | |
Protein |
rho |
PMID:16606699 |
Experiment(s):EBI-1147147 | |
Protein |
rpoB |
PMID:16606699 |
Experiment(s):EBI-1147147 | |
Protein |
mukB |
PMID:16606699 |
Experiment(s):EBI-1147147 | |
Protein |
sucB |
PMID:16606699 |
Experiment(s):EBI-1147147 | |
Protein |
ynaA |
PMID:16606699 |
Experiment(s):EBI-1147147 | |
Protein |
wza |
PMID:16606699 |
Experiment(s):EBI-1147147 | |
Protein |
rapA |
PMID:16606699 |
Experiment(s):EBI-1147147 | |
Protein |
kefA |
PMID:15690043 |
Experiment(s):EBI-893067 | |
Protein |
rplD |
PMID:15690043 |
Experiment(s):EBI-893067 | |
Protein |
rplL |
PMID:15690043 |
Experiment(s):EBI-893067 | |
Protein |
rplV |
PMID:15690043 |
Experiment(s):EBI-893067 | |
Protein |
rplW |
PMID:15690043 |
Experiment(s):EBI-893067 | |
Protein |
rpmB |
PMID:15690043 |
Experiment(s):EBI-893067 | |
Protein |
rpsB |
PMID:15690043 |
Experiment(s):EBI-893067 | |
Protein |
rpsF |
PMID:15690043 |
Experiment(s):EBI-893067 | |
Protein |
rpsG |
PMID:15690043 |
Experiment(s):EBI-893067 | |
Protein |
rpsN |
PMID:15690043 |
Experiment(s):EBI-893067 | |
Protein |
rpsP |
PMID:15690043 |
Experiment(s):EBI-893067 | |
Protein |
rpsH |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplP |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
gapA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplN |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsP |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpmB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsF |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsN |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rho |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):42.833204 | |
Protein |
dnaJ |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):22.722310 | |
Protein |
rplB |
PMID:19402753 |
LCMS(ID Probability):93.1 MALDI(Z-score):38.553054 | |
Protein |
rpsC |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):21.904713 | |
Protein |
pssA |
PMID:19402753 |
MALDI(Z-score):20.384978 | |
Protein |
rplW |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsJ |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):14.949782 | |
Protein |
rpsU |
PMID:19402753 |
LCMS(ID Probability):99.2 | |
Protein |
kefA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplD |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
deaD |
PMID:19402753 |
MALDI(Z-score):23.328459 | |
Protein |
rapA |
PMID:19402753 |
MALDI(Z-score):18.521811 | |
Protein |
rplL |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MSEAPKKRWY VVQAFSGFEG RVATSLREHI KLHNMEDLFG EVMVPTEEVV EIRGGQRRKS ERKFFPGYVL VQMVMNDASW HLVRSVPRVM GFIGGTSDRP APISDKEVDA IMNRLQQVGD KPRPKTLFEP GEMVRVNDGP FADFNGVVEE VDYEKSRLKV SVSIFGRATP VELDFSQVEK A |
Length |
181 |
Mol. Wt |
20.53 kDa |
pI |
6.9 (calculated) |
Extinction coefficient |
15,470 (calc based on 3 Y, 2 W, and 0 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0013026 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10667 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10667 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000660 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0661 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
1.60E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
E. coli K-12 MG1655 |
18635 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
3487 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
8138 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:4175746..4175786
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for nusG | |
microarray |
Summary of data for nusG from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to nusG Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10667 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0661 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10667 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000660 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0013026 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Shigella flexneri |
NUSG |
From SHIGELLACYC |
E. coli O157 |
NUSG |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10667 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10667 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000660 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0661 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0013026 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ Li, J et al. (1993) Elongation factor NusG interacts with termination factor rho to regulate termination and antitermination of transcription. Genes Dev. 7 161-72 PubMed
- ↑ Sullivan, SL & Gottesman, ME (1992) Requirement for E. coli NusG protein in factor-dependent transcription termination. Cell 68 989-94 PubMed
- ↑ Nehrke, KW & Platt, T (1994) A quaternary transcription termination complex. Reciprocal stabilization by Rho factor and NusG protein. J. Mol. Biol. 243 830-9 PubMed
- ↑ Burns, CM & Richardson, JP (1995) NusG is required to overcome a kinetic limitation to Rho function at an intragenic terminator. Proc. Natl. Acad. Sci. U.S.A. 92 4738-42 PubMed
- ↑ Washburn, RS et al. (1996) The mechanism of early transcription termination by Rho026. J. Mol. Biol. 260 347-58 PubMed
- ↑ Washburn, RS & Gottesman, ME (2011) Transcription termination maintains chromosome integrity. Proc. Natl. Acad. Sci. U.S.A. 108 792-7 PubMed
- ↑ Cardinale, CJ et al. (2008) Termination factor Rho and its cofactors NusA and NusG silence foreign DNA in E. coli. Science 320 935-8 PubMed
- ↑ 12.0 12.1 CGSC: The Coli Genetics Stock Center
- ↑ 13.0 13.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories