{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	nusG
Gene Synonym(s)	ECK3973, b3982, JW3945^[1], JW3945
Product Desc.	transcription termination factor NusG^[2]^[3] Stabilizes phage lambda protein N-NusA-RNAP antitermination complex^[4]
Product Synonyms(s)	transcription termination factor^[1], B3982^[2]^[1], NusG^[2]^[1] , ECK3973, JW3945, b3982
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): secE-nusG^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Binds TrxA (Kumar, 2004).^[4]

Binds Rho ^[5]

Required for Rho-dependent termination in vivo ^[6] and enhances Rho-dependent termination in vitro ^[7] ^[8] ^[9]

Maintains genomic integrity ^[10]

Essential in rac+ strains to prevent expression of toxic prophage gene kilR ^[11]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	nusG
Mnemonic	N (phage lambda protein) utilization substance
Synonyms	ECK3973, b3982, JW3945^[1], JW3945
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	90 minutes	MG1655: 4175766..4176311 <gbrowseImage> name=NC_000913:4175766..4176311 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 4157354..4157899 <gbrowseImage> name=NC_012967:4157354..4157899 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 4065446..4065991 <gbrowseImage> name=NC_012759:4065446..4065991 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3458938..3458393 <gbrowseImage> name=NC_007779:3458393..3458938 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4275462..4276007 <gbrowseImage> name=NC_010473:4275462..4276007 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	4175769	Edman degradation	PMID:9600841 PMID:9740056
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
MDS42 nusG(del)	deletion		Sensitivity to	increases sensitivity to Bicyclomycin	PMID:21183718		see Figure 2A
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3945	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCTCTGAAGCTCCTAAAAAGCG Primer 2:CCGGCTTTTTCAACCTGGCTGAA
E11C11	Kohara Phage	Genobase	PMID:3038334
argE86::Tn10	Linked marker	CAG12185 = CGSC7471^[12]	est. P1 cotransduction: 42% ^[13]
thiC39::Tn10	Linked marker	CAG18500 = CGSC7472^[12]	est. P1 cotransduction: 51% ^[13] Synonyms:thi-39::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10667	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10667	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000660	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948485	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0661	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013026	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	NusG
Synonyms	transcription termination factor^[1], B3982^[2]^[1], NusG^[2]^[1] , ECK3973, JW3945, b3982
Product description	transcription termination factor NusG^[2]^[3] Stabilizes phage lambda protein N-NusA-RNAP antitermination complex^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0003711	transcription elongation regulator activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001062	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003711	transcription elongation regulator activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006645	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006350	transcription	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0804	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006353	transcription termination	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0806	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006355	regulation of transcription, DNA-dependent	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001062	P	Seeded from EcoCyc (v14.0)	complete
	GO:0031564	transcription antitermination	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0889	P	Seeded from EcoCyc (v14.0)	complete
	GO:0032968	positive regulation of RNA elongation from RNA polymerase II promoter	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006645	P	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	macA	PMID:15690043^[14]	Experiment(s):EBI-886705
Protein	arnA	PMID:15690043^[14]	Experiment(s):EBI-886705
Protein	dnaJ	PMID:15690043^[14]	Experiment(s):EBI-886705
Protein	rapA	PMID:15690043^[14]	Experiment(s):EBI-886705
Protein	mreB	PMID:15690043^[14]	Experiment(s):EBI-886705, EBI-893751
Protein	pssA	PMID:15690043^[14]	Experiment(s):EBI-886705
Protein	rho	PMID:15690043^[14]	Experiment(s):EBI-886705, EBI-891277, EBI-893067
Protein	rplB	PMID:15690043^[14]	Experiment(s):EBI-886705
Protein	rplE	PMID:15690043^[14]	Experiment(s):EBI-886705
Protein	rpoA	PMID:15690043^[14]	Experiment(s):EBI-886705, EBI-879354, EBI-883271, EBI-893067
Protein	rpoB	PMID:15690043^[14]	Experiment(s):EBI-886705, EBI-879304, EBI-883170
Protein	rpoC	PMID:15690043^[14]	Experiment(s):EBI-886705, EBI-879261, EBI-883046
Protein	rpsC	PMID:15690043^[14]	Experiment(s):EBI-886705
Protein	rpsE	PMID:15690043^[14]	Experiment(s):EBI-886705, EBI-893067
Protein	rpsJ	PMID:15690043^[14]	Experiment(s):EBI-886705, EBI-893067
Protein	secA	PMID:15690043^[14]	Experiment(s):EBI-886705
Protein	sgbH	PMID:15690043^[14]	Experiment(s):EBI-886705
Protein	yacL	PMID:15690043^[14]	Experiment(s):EBI-886705, EBI-879082, EBI-882523, EBI-893067
Protein	deaD	PMID:15690043^[14]	Experiment(s):EBI-886705
Protein	rpoA	PMID:16606699^[15]	Experiment(s):EBI-1147147
Protein	rpoC	PMID:16606699^[15]	Experiment(s):EBI-1147147
Protein	iscS	PMID:16606699^[15]	Experiment(s):EBI-1147147
Protein	rho	PMID:16606699^[15]	Experiment(s):EBI-1147147
Protein	rpoB	PMID:16606699^[15]	Experiment(s):EBI-1147147
Protein	mukB	PMID:16606699^[15]	Experiment(s):EBI-1147147
Protein	sucB	PMID:16606699^[15]	Experiment(s):EBI-1147147
Protein	ynaA	PMID:16606699^[15]	Experiment(s):EBI-1147147
Protein	wza	PMID:16606699^[15]	Experiment(s):EBI-1147147
Protein	rapA	PMID:16606699^[15]	Experiment(s):EBI-1147147
Protein	kefA	PMID:15690043^[14]	Experiment(s):EBI-893067
Protein	rplD	PMID:15690043^[14]	Experiment(s):EBI-893067
Protein	rplL	PMID:15690043^[14]	Experiment(s):EBI-893067
Protein	rplV	PMID:15690043^[14]	Experiment(s):EBI-893067
Protein	rplW	PMID:15690043^[14]	Experiment(s):EBI-893067
Protein	rpmB	PMID:15690043^[14]	Experiment(s):EBI-893067
Protein	rpsB	PMID:15690043^[14]	Experiment(s):EBI-893067
Protein	rpsF	PMID:15690043^[14]	Experiment(s):EBI-893067
Protein	rpsG	PMID:15690043^[14]	Experiment(s):EBI-893067
Protein	rpsN	PMID:15690043^[14]	Experiment(s):EBI-893067
Protein	rpsP	PMID:15690043^[14]	Experiment(s):EBI-893067
Protein	rpsH	PMID:19402753^[16]	LCMS(ID Probability):99.6
Protein	rplP	PMID:19402753^[16]	LCMS(ID Probability):99.6
Protein	gapA	PMID:19402753^[16]	LCMS(ID Probability):99.6
Protein	rplN	PMID:19402753^[16]	LCMS(ID Probability):99.6
Protein	rpsP	PMID:19402753^[16]	LCMS(ID Probability):99.6
Protein	rpmB	PMID:19402753^[16]	LCMS(ID Probability):99.6
Protein	rpsF	PMID:19402753^[16]	LCMS(ID Probability):99.6
Protein	rpsN	PMID:19402753^[16]	LCMS(ID Probability):99.6
Protein	rho	PMID:19402753^[16]	LCMS(ID Probability):99.6 MALDI(Z-score):42.833204
Protein	dnaJ	PMID:19402753^[16]	LCMS(ID Probability):99.6 MALDI(Z-score):22.722310
Protein	rplB	PMID:19402753^[16]	LCMS(ID Probability):93.1 MALDI(Z-score):38.553054
Protein	rpsC	PMID:19402753^[16]	LCMS(ID Probability):99.6 MALDI(Z-score):21.904713
Protein	pssA	PMID:19402753^[16]	MALDI(Z-score):20.384978
Protein	rplW	PMID:19402753^[16]	LCMS(ID Probability):99.6
Protein	rpsJ	PMID:19402753^[16]	LCMS(ID Probability):99.6 MALDI(Z-score):14.949782
Protein	rpsU	PMID:19402753^[16]	LCMS(ID Probability):99.2
Protein	kefA	PMID:19402753^[16]	LCMS(ID Probability):99.6
Protein	rplD	PMID:19402753^[16]	LCMS(ID Probability):99.6
Protein	deaD	PMID:19402753^[16]	MALDI(Z-score):23.328459
Protein	rapA	PMID:19402753^[16]	MALDI(Z-score):18.521811
Protein	rplL	PMID:19402753^[16]	LCMS(ID Probability):99.6
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MSEAPKKRWY VVQAFSGFEG RVATSLREHI KLHNMEDLFG EVMVPTEEVV EIRGGQRRKS ERKFFPGYVL VQMVMNDASW HLVRSVPRVM GFIGGTSDRP APISDKEVDA IMNRLQQVGD KPRPKTLFEP GEMVRVNDGP FADFNGVVEE VDYEKSRLKV SVSIFGRATP VELDFSQVEK A
Length	181
Mol. Wt	20.53 kDa
pI	6.9 (calculated)
Extinction coefficient	15,470 (calc based on 3 Y, 2 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P0AFG0
Domain	130..165	PF00467 KOW motif		PMID:19920124^[17]
Domain	7..106	PF02357 Transcription termination factor nusG		PMID:19920124^[17]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=nusG taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131812	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948485	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013026	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0AFG0	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10667	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10667	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948485	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000660	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0661	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MC4100	1.60E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI	PMID:18304323
Protein	E. coli K-12 MG1655	18635	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	3487	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	8138	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
secE-nusG
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:4175746..4175786 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3982 (EcoliWiki Page)	NCBI GEO profiles for nusG
microarray	GenExpDB:b3982 (EcoliWiki Page)	Summary of data for nusG from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to nusG Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10667	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0661	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3982
EcoGene	EcoGene:EG10667	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000660	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013026	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	NUSG	From SHIGELLACYC
E. coli O157	NUSG	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00467 KOW motif
Pfam (EcoliWiki Page)	PF02357 Transcription termination factor nusG
Superfamily (EcoliWiki Page)	SUPERFAMILY:50104
Superfamily (EcoliWiki Page)	SUPERFAMILY:82679
EcoCyc	EcoCyc:EG10667	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10667	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000660	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0661	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013026	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ Li, J et al. (1993) Elongation factor NusG interacts with termination factor rho to regulate termination and antitermination of transcription. Genes Dev. 7 161-72 PubMed
↑ Sullivan, SL & Gottesman, ME (1992) Requirement for E. coli NusG protein in factor-dependent transcription termination. Cell 68 989-94 PubMed
↑ Nehrke, KW & Platt, T (1994) A quaternary transcription termination complex. Reciprocal stabilization by Rho factor and NusG protein. J. Mol. Biol. 243 830-9 PubMed
↑ Burns, CM & Richardson, JP (1995) NusG is required to overcome a kinetic limitation to Rho function at an intragenic terminator. Proc. Natl. Acad. Sci. U.S.A. 92 4738-42 PubMed
↑ Washburn, RS et al. (1996) The mechanism of early transcription termination by Rho026. J. Mol. Biol. 260 347-58 PubMed
↑ Washburn, RS & Gottesman, ME (2011) Transcription termination maintains chromosome integrity. Proc. Natl. Acad. Sci. U.S.A. 108 792-7 PubMed
↑ Cardinale, CJ et al. (2008) Termination factor Rho and its cofactors NusA and NusG silence foreign DNA in E. coli. Science 320 935-8 PubMed
↑ ^12.0 ^12.1 CGSC: The Coli Genetics Stock Center
↑ ^13.0 ^13.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^14.00 ^14.01 ^14.02 ^14.03 ^14.04 ^14.05 ^14.06 ^14.07 ^14.08 ^14.09 ^14.10 ^14.11 ^14.12 ^14.13 ^14.14 ^14.15 ^14.16 ^14.17 ^14.18 ^14.19 ^14.20 ^14.21 ^14.22 ^14.23 ^14.24 ^14.25 ^14.26 ^14.27 ^14.28 ^14.29 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^15.00 ^15.01 ^15.02 ^15.03 ^15.04 ^15.05 ^15.06 ^15.07 ^15.08 ^15.09 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^16.00 ^16.01 ^16.02 ^16.03 ^16.04 ^16.05 ^16.06 ^16.07 ^16.08 ^16.09 ^16.10 ^16.11 ^16.12 ^16.13 ^16.14 ^16.15 ^16.16 ^16.17 ^16.18 ^16.19 ^16.20 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ ^17.0 ^17.1 Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed

nusG:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to nusG Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search