nupG:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
nupG |
---|---|
Mnemonic |
Nucleoside permease |
Synonyms | |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
66.9 minutes |
MG1655: 3103736..3104992 |
||
NC_012967: 2991375..2992631 |
||||
NC_012759: 2990884..2992140 |
||||
W3110 |
|
W3110: 3104370..3105626 |
||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
nupG(del) (Keio:JW2932) |
deletion |
deletion |
|||||
nupG::Tn5KAN-I-SceI (FB20994) |
Insertion at nt 723 in Minus orientation |
contains pKD46 | |||||
nupG::Tn5KAN-I-SceI (FB20995) |
Insertion at nt 723 in Minus orientation |
does not contain pKD46 | |||||
nupG511::Tn10 |
Insertion at 3,104,399 bp in MG1655 (NC_000913) |
adapted from Nichols et al.[6] |
Synonyms: | ||||
nupG511::Tn10 |
|||||||
nupG3157::Tn10kan |
|||||||
nupG739(del)::kan |
|||||||
gru + |
Resistant to |
resistant to showdomycin |
SO736 |
||||
nupC - nupG - |
Resistant to |
|
figure 1 | ||||
nupG in strain S0 1131 |
Resistant to |
Resistance to Fluorodeoxyuridine |
S0 1131 |
||||
nupG nupC - |
Resistant to |
Resistant to showdomycin |
S0 1131 |
Figure 5 | |||
nupG in strain S0 861 |
Resistant to |
Resistance to 5-fluoro 2'deoxycytidine |
S0 861 |
2A | |||
edit table |
<protect></protect>
Notes
Mutants containing the nupG system were obtained by mating and recombination in a transport negative strain, SΦ587. [2] The nupG system determines high-affinity nucleoside transport across the cell membrane. nupG+ results in nucleoside transport and these imported nucleosides serve as antecedents of DNA and RNA. nupG- is a mutant and does not allow nucleoside transport across the membrane. [9]
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW2932 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAATCTTAAGCTGCAGCTGAA Primer 2:CCGTGGCTAACCGTCTGTGTGCC | |
Kohara Phage |
|||
Linked marker |
est. P1 cotransduction: 52% [6] | ||
Linked marker |
est. P1 cotransduction: 12% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 Munch-Petersen, A & Mygind, B (1976) Nucleoside transport systems in Escherichia coli K12: specificity and regulation. J. Cell. Physiol. 89 551-9 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 4.3 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 6.0 6.1 6.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed
- ↑ 8.0 8.1 8.2 Munch-Petersen, A et al. (1979) Nucleoside transport in cells and membrane vesicles from Escherichia coli K12. J. Biol. Chem. 254 3730-7 PubMed
- ↑ Westh Hansen, SE et al. (1987) Studies on the sequence and structure of the Escherichia coli K-12 nupG gene, encoding a nucleoside-transport system. Eur. J. Biochem. 168 385-91 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed