nuoH:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
nuoH |
|---|---|
| Gene Synonym(s) |
ECK2276, b2282, JW2277[1], JW2277 |
| Product Desc. |
Component of NADH dehydrogenase I[2][3] NADH:ubiquinone oxidoreductase subunit H, complex I; NADH dehydrogenase I[4] |
| Product Synonyms(s) |
NADH:ubiquinone oxidoreductase, membrane subunit H[1], B2282[2][1], NuoH[2][1] , ECK2276, JW2277, b2282 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): nuoABCEFGHIJKLMN[2], nuo1-14 |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
nuoH |
|---|---|
| Mnemonic |
NADH:ubiquinone oxidoreductase |
| Synonyms |
ECK2276, b2282, JW2277[1], JW2277 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
51.61 minutes |
MG1655: 2395464..2394487 |
||
|
NC_012967: 2341033..2340056 |
||||
|
NC_012759: 2280292..2281269 |
||||
|
W3110 |
|
W3110: 2402112..2401135 |
||
|
DH10B: 2487229..2486252 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
nuoH(del) (Keio:JW2277) |
deletion |
deletion |
PMID:16738554 |
||||
|
nuoH::Tn5KAN-2 (FB20740) |
Insertion at nt 323 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
|
nuoH::Tn5KAN-2 (FB20741) |
Insertion at nt 323 in Plus orientation |
PMID:15262929 |
contains pKD46 | ||||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire Dextrin |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactose |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Mannitol |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire b-Methyl-D-glucoside |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-D-Glucose |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-D-Glucose-1-phosphate |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-D-Glucose-6-phosphate |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire DL-a-Glycerol |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire DL-Lactate |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire Glucuronamide |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire Glycyl-L-aspartate |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
PMID:16095938 |
|||
|
nuoH(del)::kan |
deletion |
Biolog:respiration |
unable to respire Uridine |
PMID:16095938 |
|||
|
nuoH764(del)::kan |
PMID:16738554 |
||||||
|
nuoH764(del)::FRT |
deletion |
Mutagenesis Rate |
Decrease in Stress Induced Mutagenesis (SIM). |
PMID:23224554 |
Parent Strain: SMR4562 Wild Type Strain: SMR13654 |
The mutation caused a strong reduction in SIM with a decrease of mutant frequency by over 90 % of the wild type. See figure S3 for experimental results. | |
|
nuoH764(del)::FRT |
deletion |
Sensitivity to |
SDS-EDTA Sensitivity |
PMID:23224554 |
Parent Strain: SMR4562 Wild Type Strain: SMR13654 |
The mutation caused an increase in SDS-EDTA Sensitivity. See table S7 and S1 for a summary of experimental results. | |
|
SMR4562 yiaG-yfp FRTcatFRT nuoH764(del)::FRTKanFR |
deletion |
Sigma S activity |
Decrease in SigmaS activity. |
PMID:23224554 |
Parental Strain: SMR10582 Experimental Strain: SMR14287 |
See table S8 for full experimental data. | |
|
CAG45114 nuoH764::FRTKanFRT |
Insertion |
SigmaE activity |
Decrease in sigmaE activity |
PMID:23224554 |
Parental Strain: CAG45114 Experimental Strain: SMR15249 |
See table S11 for full experimental data. | |
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2277 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAGTTGGATATCACCGGAACT Primer 2:CCTTGCGCCTGCCAGAGAATGAC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 85% [6] | ||
|
zfd-1::Tn10 |
Linked marker |
est. P1 cotransduction: % [6] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG12088 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12088 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001993 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB2012 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0007541 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
NuoH |
|---|---|
| Synonyms |
NADH:ubiquinone oxidoreductase, membrane subunit H[1], B2282[2][1], NuoH[2][1] , ECK2276, JW2277, b2282 |
| Product description |
Component of NADH dehydrogenase I[2][3] NADH:ubiquinone oxidoreductase subunit H, complex I; NADH dehydrogenase I[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0016491 |
oxidoreductase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0048038 |
quinone binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0874 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
The NADH dehydrogenase I complex fractionates with cytoplasmic membranes. |
complete | ||
|
GO:0050136 |
NADH dehydrogenase (quinone) activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:1.6.99.5 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
Contributes to |
GO:0003954 |
NADH dehydrogenase activity |
PMID:3122832 |
IDA: Inferred from Direct Assay |
F |
Purified NADH dehydrogenase I in membrane vesicles can oxidize NADH. |
complete | |
|
GO:0030964 |
NADH dehydrogenase complex |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
E. coli NADH dehydrogenase I was purified and the subunits separated by SDS-PAGE. These seven subunits were not recovered from the gel in sufficient amounts to allow Edman degradation. The polypeptides were assigned to their respective genes based on their apparent molecular masses. |
complete | ||
|
GO:0055114 |
oxidation reduction |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01350 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001694 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR018086 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of NADH dehydrogenase I |
could be indirect |
| |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
plasma membrane |
C-terminus localized to the periplasm with 8 predicted transmembrane domains |
Daley et al. (2005) [7] |
||
|
plasma membrane |
From EcoCyc[3] |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MSWISPELIE ILLTILKAVV ILLVVVTCGA FMSFGERRLL GLFQNRYGPN RVGWGGSLQL VADMIKMFFK EDWIPKFSDR VIFTLAPMIA FTSLLLAFAI VPVSPGWVVA DLNIGILFFL MMAGLAVYAV LFAGWSSNNK YSLLGAMRAS AQTLSYEVFL GLSLMGVVAQ AGSFNMTDIV NSQAHVWNVI PQFFGFITFA IAGVAVCHRH PFDQPEAEQE LADGYHIEYS GMKFGLFFVG EYIGIVTISA LMVTLFFGGW QGPLLPPFIW FALKTAFFMM MFILIRASLP RPRYDQVMSF GWKICLPLTL INLLVTAAVI LWQAQ |
| Length |
325 |
| Mol. Wt |
36.22 kDa |
| pI |
7.2 (calculated) |
| Extinction coefficient |
66,920 - 67,295 (calc based on 8 Y, 10 W, and 3 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0007541 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG12088 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12088 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001993 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2012 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MG1655 |
1631 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
626 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
740 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:2395444..2395484
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for nuoH | |
|
microarray |
Summary of data for nuoH from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to nuoH Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG12088 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2012 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12088 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001993 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0007541 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Danio rerio |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
NUOH |
From SHIGELLACYC |
|
E. coli O157 |
NUOH |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG12088 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12088 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001993 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2012 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0007541 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
Categories
- TMHMM Prediction
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Danio rerio
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Gallus gallus
- Genes with homologs in Homo sapiens
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157



