{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	mutM
Gene Synonym(s)	ECK3625, b3635, JW3610, fpg^[1], fpg
Product Desc.	formamidopyrimidine DNA glycosylase^[2]^[3] Formamidopyrimidine-DNA glycosylase/AP lyase; 5'-terminal deoxyribophosphodiesterase; DNA repair; GC to TA; binds Zn(II)^[4]
Product Synonyms(s)	formamidopyrimidine/5-formyluracil/ 5-hydroxymethyluracil DNA glycosylase^[1], B3635^[2]^[1], Fpg^[2]^[1], MutM^[2]^[1] , ECK3625, fpg, JW3610, b3635
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): mutM^[2], rpmBG-mutM^[2], yicR-rpmBG-mutM^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	mutM
Mnemonic	Mutator
Synonyms	ECK3625, b3635, JW3610, fpg^[1], fpg
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	82.08 minutes	MG1655: 3809175..3808366 <gbrowseImage> name=NC_000913:3808366..3809175 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 3749507..3748698 <gbrowseImage> name=NC_012967:3748698..3749507 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 3696692..3697501 <gbrowseImage> name=NC_012759:3696692..3697501 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3829263..3830072 <gbrowseImage> name=NC_007779:3829263..3830072 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 3906752..3905943 <gbrowseImage> name=NC_010473:3905943..3906752 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	3808369	Edman degradation	PMID:3319582
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Description	Reference	Availability	Comments
mutM(del) (Keio:JW3610)	deletion	deletion		PMID:16738554	Shigen
mutM::Tn5KAN-I-SceI (FB21352)	Insertion at nt 312 in Plus orientation			PMID:15262929	E. coli Genome Project:FB21352	contains pKD46
mutM::Tn5KAN-I-SceI (FB21353)	Insertion at nt 312 in Plus orientation			PMID:15262929	E. coli Genome Project:FB21353	does not contain pKD46
mutMK218T		K218T	Slight increase of substrate affinity and decrease of activity			seeded from UniProt:P05523
mutME174Q		E174Q	Strong decrease of glycosylase activity; slight decrease of AP lyase activity			seeded from UniProt:P05523
mutME3Q		E3Q	Strong decrease of glycosylase activity; slight decrease of AP lyase activity			seeded from UniProt:P05523
mutME6Q		E6Q	Decrease of glycosylase activity; no effect on AP lyase activity			seeded from UniProt:P05523
mutMH90A		H90A	Increase of substrate affinity and decrease of activity			seeded from UniProt:P05523
mutMD107N		D107N	No effect on glycosylase and AP lyase activity			seeded from UniProt:P05523
mutMR109A		R109A	Over 100-fold decrease of activity			seeded from UniProt:P05523
mutMR110A		R110A	Over 100-fold increase of substrate affinity and decrease of activity			seeded from UniProt:P05523
mutME132Q		E132Q	Decrease of glycosylase activity; slight decrease of AP lyase activity			seeded from UniProt:P05523
mutMD160N		D160N	No effect on glycosylase and AP lyase activity			seeded from UniProt:P05523
mutM102::kan				PMID:8676878	CGSC:67990
mutM103::mini-Tn10				PMID:8676878	CGSC:67993
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3610	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCCCTGAATTACCCGAAGTTGA Primer 2:CCtTTCTGGCACTGCCGACAATA
2A6	Kohara Phage	Genobase	PMID:3038334
4D2	Kohara Phage	Genobase	PMID:3038334
zhg-50::Tn10	Linked marker	CAG18450 = CGSC7450^[5]	est. P1 cotransduction: % ^[6] Synonyms:zhf-50::Tn10, zhf-5::Tn10
zic-4901::Tn10	Linked marker	CAG18492 = CGSC7457^[5]	est. P1 cotransduction: 50% ^[6]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10329	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10329	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000323	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:946765	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0325	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0011877	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	MutM
Synonyms	formamidopyrimidine/5-formyluracil/ 5-hydroxymethyluracil DNA glycosylase^[1], B3635^[2]^[1], Fpg^[2]^[1], MutM^[2]^[1] , ECK3625, fpg, JW3610, b3635
Product description	formamidopyrimidine DNA glycosylase^[2]^[3] Formamidopyrimidine-DNA glycosylase/AP lyase; 5'-terminal deoxyribophosphodiesterase; DNA repair; GC to TA; binds Zn(II)^[4]
EC number (for enzymes)	3.2.2.23^[1]
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0019104	DNA N-glycosylase activity	PMID:2664776^[7]	IDA: Inferred from Direct Assay		F		complete
	GO:0004519	endonuclease activity	PMID:2664776^[7]	IDA: Inferred from Direct Assay		F	nicking at AP sites	complete
	GO:0003676	nucleic acid binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR010979	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015887	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0238	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003684	damaged DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR012319	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003684	damaged DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015886	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003906	DNA-(apurinic or apyrimidinic site) lyase activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00103	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003906	DNA-(apurinic or apyrimidinic site) lyase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000191	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008270	zinc ion binding	PMID:8473347^[8]	IDA: Inferred from Direct Assay		F		complete
	GO:0003906	DNA-(apurinic or apyrimidinic site) lyase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000214	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046872	metal ion binding	PMID:8473347^[8]	IDA: Inferred from Direct Assay		F	Cu(II), Cd(II), Hg(II) bind the protein	complete
	GO:0003906	DNA-(apurinic or apyrimidinic site) lyase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR012319	F	Seeded from EcoCyc (v14.0)	complete
	GO:0019104	DNA N-glycosylase activity	PMID:8473347^[8]	IDA: Inferred from Direct Assay		F		complete
	GO:0003906	DNA-(apurinic or apyrimidinic site) lyase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015886	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003906	DNA-(apurinic or apyrimidinic site) lyase activity	PMID:8473347^[8]	IDA: Inferred from Direct Assay		F		complete
	GO:0003906	DNA-(apurinic or apyrimidinic site) lyase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015887	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003906	DNA-(apurinic or apyrimidinic site) lyase activity	GOA:spec GO_REF:0000003	IEA: Inferred from Electronic Annotation	EC:4.2.99.18	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006974	response to DNA damage stimulus	PMID:1731864^[9]	IDA: Inferred from Direct Assay		P		complete
	GO:0006281	DNA repair	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00103	P	Seeded from EcoCyc (v14.0)	complete
	GO:0003906	DNA-(apurinic or apyrimidinic site) lyase activity	PMID:1731864^[9]	IDA: Inferred from Direct Assay		F		complete
	GO:0004519	endonuclease activity	PMID:8473347^[8]	IDA: Inferred from Direct Assay		F		complete
	GO:0006281	DNA repair	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000191	P	Seeded from EcoCyc (v14.0)	complete
	GO:0019104	DNA N-glycosylase activity	PMID:1649454^[10]	EXP: Inferred from Experiment		F		complete
	GO:0006281	DNA repair	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000214	P	Seeded from EcoCyc (v14.0)	complete
	GO:0004519	endonuclease activity	PMID:1649454^[10]	EXP: Inferred from Experiment		F		complete
	GO:0004519	endonuclease activity	PMID:1731864^[9]	IDA: Inferred from Direct Assay		F		complete
	GO:0006281	DNA repair	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015887	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006281	DNA repair	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020629	P	Seeded from EcoCyc (v14.0)	complete
	GO:0019104	DNA N-glycosylase activity	PMID:10862773^[11]	IDA: Inferred from Direct Assay		F		complete
	GO:0006281	DNA repair	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0234	P	Seeded from EcoCyc (v14.0)	complete
	GO:0003684	damaged DNA binding	PMID:10862773^[11]	IDA: Inferred from Direct Assay		F		complete
	GO:0006284	base-excision repair	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR012319	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006289	nucleotide-excision repair	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015886	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006974	response to DNA damage stimulus	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0227	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008152	metabolic process	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0326	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008270	zinc ion binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000191	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008270	zinc ion binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000214	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008270	zinc ion binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR012319	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008270	zinc ion binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015886	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008270	zinc ion binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015887	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008270	zinc ion binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020629	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008270	zinc ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0862	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008534	oxidized purine base lesion DNA N-glycosylase activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00103	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008534	oxidized purine base lesion DNA N-glycosylase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000191	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008534	oxidized purine base lesion DNA N-glycosylase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020629	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008534	oxidized purine base lesion DNA N-glycosylase activity	GOA:spec GO_REF:0000003	IEA: Inferred from Electronic Annotation	EC:3.2.2.23	F	Seeded from EcoCyc (v14.0)	complete
	GO:0016829	lyase activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0456	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046872	metal ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0479	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046872	metal ion binding	PMID:8473347^[8]	IDA: Inferred from Direct Assay		F	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	glpT		PMID:16606699^[12]	Experiment(s):EBI-1146365
Protein	thiI		PMID:16606699^[12]	Experiment(s):EBI-1146365
Protein	ilvI		PMID:16606699^[12]	Experiment(s):EBI-1146365
Protein	mscL		PMID:19402753^[13]	LCMS(ID Probability):98.9
Small Molecule	PMPS	Inhibitor	PMID:8473347^[8]	Activity Assays
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MPELPEVETS RRGIEPHLVG ATILHAVVRN GRLRWPVSEE IYRLSDQPVL SVQRRAKYLL LELPEGWIII HLGMSGSLRI LPEELPPEKH DHVDLVMSNG KVLRYTDPRR FGAWLWTKEL EGHNVLTHLG PEPLSDDFNG EYLHQKCAKK KTAIKPWLMD NKLVVGVGNI YASESLFAAG IHPDRLASSL SLAECELLAR VIKAVLLRSI EQGGTTLKDF LQSDGKPGYF AQELQVYGRK GEPCRVCGTP IVATKHAQRA TFYCRQCQK
Length	269
Mol. Wt	30.29 kDa
pI	8.6 (calculated)
Extinction coefficient	39,420 - 40,170 (calc based on 8 Y, 5 W, and 6 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P05523
Domain	2..115	PF01149 Formamidopyrimidine-DNA glycosylase N-terminal domain		PMID:19920124^[14]
Domain	241..269	PF06827 Zinc finger found in FPG and IleRS		PMID:19920124^[14]
Domain	129..220	PF06831 Formamidopyrimidine-DNA glycosylase H2TH domain		PMID:19920124^[14]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=mutM taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131506	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:946765	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0011877	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P05523	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10329	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10329	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:946765	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000323	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0325	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	Ecoli K-12	1.208+/-0.056	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.012360939	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	684	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	86	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	511	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
mutM
rpmBG-mutM
yicR-rpmBG-mutM
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:3809155..3809195 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3635 (EcoliWiki Page)	NCBI GEO profiles for mutM
microarray	GenExpDB:b3635 (EcoliWiki Page)	Summary of data for mutM from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (3808710..3808899) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ12; Well:F6^[15]
edit table

Notes

Accessions Related to mutM Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10329	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0325	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3635
EcoGene	EcoGene:EG10329	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000323	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0011877	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Arabidopsis thaliana	AT1G52500 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Oryza gramene	Q69RX3 (score: 1.000; bootstrap: 100%) Q6UU93 (score: 0.875) Q67WP0 (score: 0.438) Q761Y8 (score: 0.280)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000033641 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	MUTM	From SHIGELLACYC
E. coli O157	MUTM	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF01149 Formamidopyrimidine-DNA glycosylase N-terminal domain
Superfamily (EcoliWiki Page)	SUPERFAMILY:46946
Superfamily (EcoliWiki Page)	SUPERFAMILY:57716
Superfamily (EcoliWiki Page)	SUPERFAMILY:81624
Pfam (EcoliWiki Page)	PF06827 Zinc finger found in FPG and IleRS
Pfam (EcoliWiki Page)	PF06831 Formamidopyrimidine-DNA glycosylase H2TH domain
EcoCyc	EcoCyc:EG10329	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10329	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000323	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0325	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0011877	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^7.0 ^7.1 O'Connor, TR & Laval, J (1989) Physical association of the 2,6-diamino-4-hydroxy-5N-formamidopyrimidine-DNA glycosylase of Escherichia coli and an activity nicking DNA at apurinic/apyrimidinic sites. Proc. Natl. Acad. Sci. U.S.A. 86 5222-6 PubMed
↑ ^8.0 ^8.1 ^8.2 ^8.3 ^8.4 ^8.5 ^8.6 O'Connor, TR et al. (1993) Fpg protein of Escherichia coli is a zinc finger protein whose cysteine residues have a structural and/or functional role. J. Biol. Chem. 268 9063-70 PubMed
↑ ^9.0 ^9.1 ^9.2 Boiteux, S et al. (1992) Substrate specificity of the Escherichia coli Fpg protein (formamidopyrimidine-DNA glycosylase): excision of purine lesions in DNA produced by ionizing radiation or photosensitization. Biochemistry 31 106-10 PubMed
↑ ^10.0 ^10.1 Michaels, ML et al. (1991) MutM, a protein that prevents G.C----T.A transversions, is formamidopyrimidine-DNA glycosylase. Nucleic Acids Res. 19 3629-32 PubMed
↑ ^11.0 ^11.1 Hazra, TK et al. (2000) Characterization of a novel 8-oxoguanine-DNA glycosylase activity in Escherichia coli and identification of the enzyme as endonuclease VIII. J. Biol. Chem. 275 27762-7 PubMed
↑ ^12.0 ^12.1 ^12.2 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ ^14.0 ^14.1 ^14.2 Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

mutM:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to mutM Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search