mreB:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
mreB |
---|---|
Gene Synonym(s) | |
Product Desc. |
Component of longitudinal peptidoglycan synthesis/chromosome segregation-directing complex[3] MreB filaments participate in directional chromosome movement and segregation; mecillinam resistance; forms membrane-associated coiled arrays; actin homolog; morphology[4] |
Product Synonyms(s) |
cell wall structural complex MreBCD, actin-like component MreB[1], B3251[2][1], RodY[2][1], Mon[2][1], EnvB[2][1], MreB_1[2][1], MreB[2][1] , ECK3239, envB, JW3220, mon, rodY, b3251 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression |
transcription unit(s): mreBCD-yhdE-rng[2] |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Overexpression causes abnormal biofilm architecture, reduces motility and inhibits cell division. In operon with mreCD and the gene products form an essential membrane-bound complex responsible for cell morphology. Binds TrxA (Kumar, 2004).[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
mreB |
---|---|
Mnemonic |
Murein cluster e; mecillinam resistance |
Synonyms | |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
73.24 minutes |
MG1655: 3399109..3398066 |
||
NC_012967: 3328978..3327935 |
||||
NC_012759: 3285214..3286257 |
||||
W3110 |
|
W3110: 3400942..3399899 |
||
DH10B: 3496854..3495811 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
3398066 |
Edman degradation |
PMID:3049542 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
mreB11 |
|||||||
mreB(del)seqA(del) |
asynchronous initiation of chromosome replication |
PMID:10540294 |
"Temperature sensitivity, anucleate cell production and poor nucleoid folding seen in the mukB strain were suppressed by the seqA null mutation, whereas filamentation, asymmetric septation and compact folding of the nucleoids were observed in the seqA strain were suppressed by inactivation of the mukB gene function" | ||||
mreB129 |
Growth Phenotype |
at 30C supersensitive to mecillinam but resistant at 42C; contains twice the amount of FtsZ than parent strain |
PMID:2822655 PMID:17993535 |
||||
mre-129 |
Resistant to |
Mecillinam resistance at 42C |
PMID:2822655 & [5] |
Strain: AT1325-678 |
table 2 | ||
mre-678 |
Cell Shape |
spherical shaped |
PMID:2822655 & [6] |
Strain: AT1325-678 |
table 2 | ||
rodY - |
Resistant to |
Resistance to mecillinam |
PMID:201607 |
Strain: HL18 |
rodX is a suggested synonym of rodA by this paper as well as Iwaya et. al. [7] | ||
rodY - |
Colony Morphology |
Spherical Morphology |
PMID:201607 |
strain: HL18 |
rodX is a suggested synonym of rodA by this paper as well as Iwaya et. al. [7] | ||
envB(TS) |
Resistant to |
Resistant to Mecillinam at 42C on both liquid cultures and solid mediums. |
PMID:363690 |
Strain: R3-1 |
See figure 1B | ||
envB(TS) |
Cell Shape |
Spherical shapes at 42C. Wildtype Rod at 30C |
PMID:363690 |
Strain: R3-1 |
See figure 1B | ||
envB4 |
Resistant to |
Increase Resistance to UV. |
PMID:7012547 |
Strain: DA538 |
| ||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW3220 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCTTGAAAAAATTTCGTGGCAT Primer 2:CCtTCTTCGCTGAACAGGTCGCC | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 25% [9] | ||
Linked marker |
est. P1 cotransduction: 55% [9] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10608 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10608 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000601 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0603 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0010661 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
MreB |
---|---|
Synonyms |
cell wall structural complex MreBCD, actin-like component MreB[1], B3251[2][1], RodY[2][1], Mon[2][1], EnvB[2][1], MreB_1[2][1], MreB[2][1] , ECK3239, envB, JW3220, mon, rodY, b3251 |
Product description |
Component of longitudinal peptidoglycan synthesis/chromosome segregation-directing complex[3] MreB filaments participate in directional chromosome movement and segregation; mecillinam resistance; forms membrane-associated coiled arrays; actin homolog; morphology[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000902 |
cell morphogenesis |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR004753 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005524 |
ATP binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001023 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008360 |
regulation of cell shape |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0133 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051983 |
regulation of chromosome segregation |
PMID:19187760 |
IGI: Inferred from Genetic Interaction |
EcoliWiki:mreC|EcoliWiki:mreD |
P |
complete | ||
GO:0051983 |
regulation of chromosome segregation |
PMID:19187760 |
IGI: Inferred from Genetic Interaction |
P |
Seeded from EcoCyc (v14.0) |
Missing: with/from | ||
GO:0051983 |
regulation of chromosome segregation |
PMID:14517265 |
IMP: Inferred from Mutant Phenotype |
P |
complete | |||
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of longitudinal peptidoglycan synthesis/chromosome segregation-directing complex |
could be indirect |
||
Protein |
accA |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
add |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
atpD |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
clpB |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
dnaK |
PMID:15690043 |
Experiment(s):EBI-888239, EBI-893751 | |
Protein |
fusA |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
gatY |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
glyQ |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
gyrA |
PMID:15690043 |
Experiment(s):EBI-888239, EBI-884206 | |
Protein |
kefC |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
lysU |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
malK |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
malT |
PMID:15690043 |
Experiment(s):EBI-888239, EBI-879887 | |
Protein |
minD |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
groL |
PMID:15690043 |
Experiment(s):EBI-888239, EBI-893751 | |
Protein |
narG |
PMID:15690043 |
Experiment(s):EBI-888239, EBI-880367 | |
Protein |
nuoC |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
ompA |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
ompC |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
pnp |
PMID:15690043 |
Experiment(s):EBI-888239, EBI-883913 | |
Protein |
pstB |
PMID:15690043 |
Experiment(s):EBI-888239, EBI-878876 | |
Protein |
recA |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
rho |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
rplE |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
rpoB |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
rpoC |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
secA |
PMID:15690043 |
Experiment(s):EBI-888239, EBI-880477, EBI-893751 | |
Protein |
radA |
PMID:15690043 |
Experiment(s):EBI-888239 | |
Protein |
tufA |
PMID:15690043 |
Experiment(s):EBI-888239, EBI-889981, EBI-893751 | |
Protein |
yleA |
PMID:15690043 |
Experiment(s):EBI-888239, EBI-879008 | |
Protein |
ydiH |
PMID:15690043 |
Experiment(s):EBI-893751 | |
Protein |
gatB |
PMID:15690043 |
Experiment(s):EBI-893751 | |
Protein |
rplC |
PMID:15690043 |
Experiment(s):EBI-893751 | |
Protein |
rpsF |
PMID:15690043 |
Experiment(s):EBI-893751 | |
Protein |
uspG |
PMID:15690043 |
Experiment(s):EBI-893751 | |
Protein |
ybeD |
PMID:15690043 |
Experiment(s):EBI-893751 | |
Protein |
yjgD |
PMID:15690043 |
Experiment(s):EBI-893751 | |
Protein |
rraB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
ydiH |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsF |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
pnp |
PMID:19402753 |
MALDI(Z-score):22.799859 | |
Protein |
groL |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):17.053160 | |
Protein |
groS |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):24.893345 | |
Protein |
rplE |
PMID:19402753 |
MALDI(Z-score):21.654832 | |
Protein |
nusG |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):38.493587 | |
Protein |
rho |
PMID:19402753 |
MALDI(Z-score):33.870882 | |
Protein |
atpD |
PMID:19402753 |
MALDI(Z-score):20.723497 | |
Protein |
secA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):37.736144 | |
Protein |
minD |
PMID:19402753 |
MALDI(Z-score):18.389853 | |
Protein |
fusA |
PMID:19402753 |
MALDI(Z-score):23.873733 | |
Protein |
nuoC |
PMID:19402753 |
MALDI(Z-score):23.126243 | |
Protein |
ibpA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):17.053160 | |
Protein |
miaB |
PMID:19402753 |
LCMS(ID Probability):83.7 MALDI(Z-score):34.493869 | |
Protein |
dnaJ |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):34.695952 | |
Protein |
gatZ |
PMID:19402753 |
MALDI(Z-score):29.093011 | |
Protein |
uspG |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):7.859012 | |
Protein |
gatB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
ybeD |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
ompC |
PMID:19402753 |
MALDI(Z-score):30.421807 | |
Protein |
recA |
PMID:19402753 |
MALDI(Z-score):29.479724 | |
Protein |
ftsZ |
PMID:19402753 |
LCMS(ID Probability):97.2 MALDI(Z-score):30.059500 | |
Protein |
pstB |
PMID:19402753 |
MALDI(Z-score):35.461003 | |
Protein |
add |
PMID:19402753 |
MALDI(Z-score):34.358029 | |
Protein |
gatY |
PMID:19402753 |
MALDI(Z-score):25.064105 | |
Protein |
malK |
PMID:19402753 |
MALDI(Z-score):19.548643 | |
Protein |
ParC |
PMID:19187760 |
| |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MVGKVSGFSF PPQLSGLSLS MLKKFRGMFS NDLSIDLGTA NTLIYVKGQG IVLNEPSVVA IRQDRAGSPK SVAAVGHDAK QMLGRTPGNI AAIRPMKDGV IADFFVTEKM LQHFIKQVHS NSFMRPSPRV LVCVPVGATQ VERRAIRESA QGAGAREVFL IEEPMAAAIG AGLPVSEATG SMVVDIGGGT TEVAVISLNG VVYSSSVRIG GDRFDEAIIN YVRRNYGSLI GEATAERIKH EIGSAYPGDE VREIEVRGRN LAEGVPRGFT LNSNEILEAL QEPLTGIVSA VMVALEQCPP ELASDISERG MVLTGGGALL RNLDRLLMEE TGIPVVVAED PLTCVARGGG KALEMIDMHG GDLFSEE |
Length |
367 |
Mol. Wt |
38.972 kDa |
pI |
5.2 (calculated) |
Extinction coefficient |
7,450 - 7,825 (calc based on 5 Y, 0 W, and 3 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0010661 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10608 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10608 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000601 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0603 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
1.49E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
E. coli K-12 MC1000 |
17,000 |
molecules/cell |
|
quantitative western |
PMID:14517265 | |
Protein |
E. coli K-12 MC1000 |
40,000 |
molecules/cell |
|
quantitative western |
PMID:14517265 | |
Protein |
Ecoli K-12 |
210.659+/-2.217 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.25036+/-0.0169 |
Molecules/cell |
|
by FISH |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.229626079 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 EMG2 |
60 |
molecules/cell |
|
Quantitative protein sequencing |
Spot ID: Mll0-1 |
PMID: 9298646 |
Protein |
E. coli K-12 EMG2 |
80 |
molecules/cell |
|
Quantitative protein sequencing |
Spot ID: Mll0-2 |
PMID: 9298646 |
Protein |
E. coli K-12 MG1655 |
11304 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
2393 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
5570 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Identification of transcription start sites and different levels of mreB and mreBCD transcripts.[10]
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:3399089..3399129
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for mreB | |
microarray |
Summary of data for mreB from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to mreB Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10608 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0603 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10608 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000601 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0010661 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Shigella flexneri |
MREB |
From SHIGELLACYC |
E. coli O157 |
MREB |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10608 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10608 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000601 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0603 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0010661 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ Okada, Y., M. Eachi,K. Nagai, and M. Matsihashi. 1992. Chage of the quantity of penicillin-binding proteins and other cytoplasmic and membrane proteins by mutations of the cell shape-determination genes mreB mreC mreD of Escherichia coli. J. Gen. Appl. Microbiol. 38:157-167.
- ↑ Okada, Y., M. Eachi,K. Nagai, and M. Matsihashi. 1992. Chage of the quantity of penicillin-binding proteins and other cytoplasmic and membrane proteins by mutations of the cell shape-determination genes mreB mreC mreD of Escherichia coli. J. Gen. Appl. Microbiol. 38:157-167.
- ↑ 7.0 7.1 Iwaya, M et al. (1978) Morphology of an Escherichia coli mutant with a temperature-dependent round cell shape. J. Bacteriol. 136 1143-58 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Wachi, M et al. (2006) Transcriptional analysis of the Escherichia coli mreBCD genes responsible for morphogenesis and chromosome segregation. Biosci. Biotechnol. Biochem. 70 2712-9 PubMed
Categories