mreB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
mreB |
|---|---|
| Mnemonic |
Murein cluster e; mecillinam resistance |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
73.24 minutes |
MG1655: 3399109..3398066 |
||
|
NC_012967: 3328978..3327935 |
||||
|
NC_012759: 3285214..3286257 |
||||
|
W3110 |
|
W3110: 3400942..3399899 |
||
|
DH10B: 3496854..3495811 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3398066 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
mreB11 |
|||||||
|
mreB(del)seqA(del) |
asynchronous initiation of chromosome replication |
"Temperature sensitivity, anucleate cell production and poor nucleoid folding seen in the mukB strain were suppressed by the seqA null mutation, whereas filamentation, asymmetric septation and compact folding of the nucleoids were observed in the seqA strain were suppressed by inactivation of the mukB gene function" | |||||
|
mreB129 |
Growth Phenotype |
at 30C supersensitive to mecillinam but resistant at 42C; contains twice the amount of FtsZ than parent strain |
|||||
|
mre-129 |
Resistant to |
Mecillinam resistance at 42C |
Strain: AT1325-678 |
table 2 | |||
|
mre-678 |
Cell Shape |
spherical shaped |
Strain: AT1325-678 |
table 2 | |||
|
rodY - |
Resistant to |
Resistance to mecillinam |
Strain: HL18 |
rodX is a suggested synonym of rodA by this paper as well as Iwaya et. al. [11] | |||
|
rodY - |
Colony Morphology |
Spherical Morphology |
strain: HL18 |
rodX is a suggested synonym of rodA by this paper as well as Iwaya et. al. [11] | |||
|
envB(TS) |
Resistant to |
Resistant to Mecillinam at 42C on both liquid cultures and solid mediums. |
Strain: R3-1 |
See figure 1B | |||
|
envB(TS) |
Cell Shape |
Spherical shapes at 42C. Wildtype Rod at 30C |
Strain: R3-1 |
See figure 1B | |||
|
envB4 |
Resistant to |
Increase Resistance to UV. |
Strain: DA538 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3220 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTTGAAAAAATTTCGTGGCAT Primer 2:CCtTCTTCGCTGAACAGGTCGCC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 25% [16] | ||
|
Linked marker |
est. P1 cotransduction: 55% [16] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Doi, M et al. (1988) Determinations of the DNA sequence of the mreB gene and of the gene products of the mre region that function in formation of the rod shape of Escherichia coli cells. J. Bacteriol. 170 4619-24 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Weitao, T et al. (1999) Mutual suppression of mukB and seqA phenotypes might arise from their opposing influences on the Escherichia coli nucleoid structure. Mol. Microbiol. 34 157-68 PubMed
- ↑ 6.0 6.1 6.2 Wachi, M et al. (1987) Mutant isolation and molecular cloning of mre genes, which determine cell shape, sensitivity to mecillinam, and amount of penicillin-binding proteins in Escherichia coli. J. Bacteriol. 169 4935-40 PubMed
- ↑ Bendezú, FO & de Boer, PA (2008) Conditional lethality, division defects, membrane involution, and endocytosis in mre and mrd shape mutants of Escherichia coli. J. Bacteriol. 190 1792-811 PubMed
- ↑ Okada, Y., M. Eachi,K. Nagai, and M. Matsihashi. 1992. Chage of the quantity of penicillin-binding proteins and other cytoplasmic and membrane proteins by mutations of the cell shape-determination genes mreB mreC mreD of Escherichia coli. J. Gen. Appl. Microbiol. 38:157-167.
- ↑ Okada, Y., M. Eachi,K. Nagai, and M. Matsihashi. 1992. Chage of the quantity of penicillin-binding proteins and other cytoplasmic and membrane proteins by mutations of the cell shape-determination genes mreB mreC mreD of Escherichia coli. J. Gen. Appl. Microbiol. 38:157-167.
- ↑ 10.0 10.1 Iwaya, M et al. (1978) Mapping of the mecillinam-resistant, round morphological mutants of Escherichia coli. J. Bacteriol. 133 196-202 PubMed
- ↑ 11.0 11.1 11.2 11.3 Iwaya, M et al. (1978) Morphology of an Escherichia coli mutant with a temperature-dependent round cell shape. J. Bacteriol. 136 1143-58 PubMed
- ↑ Antón, DN (1981) envB mutations confer UV-sensitivity to Salmonella typhimurium and UV-resistance to Escherichia coli. Mol. Gen. Genet. 181 150-2 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 14.0 14.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 15.0 15.1 CGSC: The Coli Genetics Stock Center
- ↑ 16.0 16.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
