lamB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
lamB |
---|---|
Mnemonic |
Lambda |
Synonyms |
ECK4028, b4036, JW3996, malB, malL[1], malL |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
91.51 minutes |
MG1655: 4245994..4247334 |
||
NC_012967: 4226903..4228243 |
||||
NC_012759: 4184839..4186179 |
||||
W3110 |
|
W3110: 4251561..4252901 |
||
DH10B: 4345690..4347030 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
4246069 |
Edman degradation |
| ||
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔlamB (Keio:JW3996) |
deletion |
deletion |
|||||
lamBR134D,N |
R134D,N |
Slight increase in pore size; increase in sucrose transport and slight decrease in maltose transport; when associated with D-143 and F-146 |
seeded from UniProt:P02943 | ||||
lamBY143F |
Y143F |
Increases affinity for starch and maltose, pore size and transport of maltohexaose |
seeded from UniProt:P02943 | ||||
lamBD146G |
D146G |
Increases affinity for large dextrins |
seeded from UniProt:P02943 | ||||
lamBW99R |
W99R |
Decreases starch affinity, slightly increases maltose affinity |
seeded from UniProt:P02943 | ||||
lamBR107S |
R107S |
Decreases maltodextrin affinity, increases sucrose binding and transport |
seeded from UniProt:P02943 | ||||
lamBR134A |
R134A |
Considerable increase in pore size and sucrose transport, slight decrease in maltose transport; when associated with A-143 |
seeded from UniProt:P02943 | ||||
lamBR33H |
R33H |
Reduces ligand affinity and pore size, no longer selective for maltodextrins |
seeded from UniProt:P02943 | ||||
ΔlamB::kan |
deletion |
Biolog:respiration |
unable to respire Dextrin |
||||
lamB63 |
|||||||
lamB204(Am) |
amber (UAG) mutation | ||||||
lamB60::Tn10 |
|||||||
lamB20::Tn5 |
|||||||
lamB2000(LamR) |
lambda resistant |
||||||
ΔlamB732::kan |
| ||||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW3996 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATGATTACTCTGCGCAAACT Primer 2:CCCCACCAGATTTCCATCTGGGC | |
Kohara Phage |
|||
Kohara Phage |
|||
Linked marker |
est. P1 cotransduction: 84% [10] | ||
Linked marker |
est. P1 cotransduction: 5% [10] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Edermann, R et al. (1978) Major proteins of the Escherichia coli outer cell envelope membrane. Preliminary characterization of the phage lambda receptor protein. FEBS Lett. 88 71-4 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Hofnung, M et al. (1976) lamB mutations in E. coli K12: growth of lambda host range mutants and effect of nonsense suppressors. Mol. Gen. Genet. 145 207-13 PubMed
- ↑ Braun, V & Krieger-Brauer, HJ (1977) Interrelationship of the phage lambda receptor protein and maltose transport in mutants of Escherichia coli K12. Biochim. Biophys. Acta 469 89-98 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).