lacZ:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
lacZ |
|---|---|
| Mnemonic |
Lactose |
| Synonyms |
ECK0341, b0344, JW0335[1], JW0335 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
7.81 minutes |
MG1655: 365529..362455 |
||
|
NC_012967: 338861..335787 |
||||
|
NC_012759: 4175805..4179047 |
||||
|
W3110 |
|
W3110: 365529..362455 |
||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
362458 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
lacZD202F |
D202F |
Obliterates all binding and catalysis |
seeded from UniProt:P00722 | ||||
|
lacZD202E,N |
D202E,N |
Causes a significant decrease in binding affinity in the absence of monovalent cations or in the presence of potassium ions, but only a moderate decrease in the presence of sodium ions |
seeded from UniProt:P00722 | ||||
|
lacZW1000F,G,L,T |
W1000F,G,L,T |
Decreases affinity for substrate |
seeded from UniProt:P00722 | ||||
|
lacZF602A |
F602A |
Decreases the stability of the loop 794-804 |
seeded from UniProt:P00722 | ||||
|
lacZG795A |
G795A |
It forces the apoenzyme to adopt the closed rather than the open conformation. Reduces the binding affinity |
seeded from UniProt:P00722 | ||||
|
lacZE798A,L |
E798A,L |
The catalytic efficiency is not increased, when the sodium concentration increases |
seeded from UniProt:P00722 | ||||
|
lacZE798D,Q |
E798D,Q |
Small increase of the catalytic efficiency, when the sodium concentration increases |
seeded from UniProt:P00722 | ||||
|
lacZH541E,F,N |
H541E,F,N |
Poorly reactive with galactosyl substrates. Less stable to heat than wild-type |
seeded from UniProt:P00722 | ||||
|
lacZE538Q |
E538Q |
10000-fold decrease in the beta- galactosidase activity |
seeded from UniProt:P00722 | ||||
|
lacZE462H |
E462H |
Slowly inactivates galactosidase activity by reducing the binding of magnesium. It increases binding specificity |
seeded from UniProt:P00722 | ||||
|
lacZH358D,F,L,N |
H358D,F,L,N |
Less stable to heat than wild-type. Causes significant destabilizations of the first transition state |
seeded from UniProt:P00722 | ||||
|
lacZH392E,F,K |
H392E,F,K |
Essentially inactive unless very rapid purification. Causes very large destabilizations of the transition state |
seeded from UniProt:P00722 | ||||
|
lacZ4 |
|||||||
|
lacZ43(Fs) |
frameshift mutation | ||||||
|
lacZ53(Am) |
amber (UAG) mutation | ||||||
|
lacZ36 |
|||||||
|
lacZ125(Am) |
amber (UAG) mutation | ||||||
|
lacZ73 |
|||||||
|
lacZ46 |
|||||||
|
lacZ827(UGA) |
opal (UGA) mutation | ||||||
|
lacZ82(Am) |
amber (UAG) mutation | ||||||
|
lacZ39(del) |
|||||||
|
lacZ13(Oc) |
ochre (UAA) mutation | ||||||
|
lacZ90(Oc) |
ochre (UAA) mutation | ||||||
|
lacZ625(Am) |
amber (UAG) mutation | ||||||
|
lacZ118(Oc) |
ochre (UAA) mutation | ||||||
|
lacZ659(Oc) |
ochre (UAA) mutation | ||||||
|
lacZ404(Oc) |
ochre (UAA) mutation | ||||||
|
lacZ521(UGA) |
opal (UGA) mutation | ||||||
|
lacZ813(UGA) |
opal (UGA) mutation | ||||||
|
lacZ105(Am) |
amber (UAG) mutation | ||||||
|
lacZ178 |
|||||||
|
lacZ281(Am) |
amber (UAG) mutation | ||||||
|
lacZ57(del) |
|||||||
|
lacZ62 |
|||||||
|
lacZ608(Am) |
amber (UAG) mutation | ||||||
|
lacZ84 |
|||||||
|
lacZ75(Fs) |
frameshift mutation | ||||||
|
lacZ482(Am) |
amber (UAG) mutation | ||||||
|
lacZ58(del)(M15) |
|||||||
|
lacZ98::Tn10 |
|||||||
|
lacZ545(Am) |
amber (UAG) mutation | ||||||
|
lacZ2286(Am) |
amber (UAG) mutation | ||||||
|
lacZ624(Am) |
amber (UAG) mutation | ||||||
|
lacZ95(del) |
|||||||
|
lacZ114((delH)) |
|||||||
|
lacZ55 |
|||||||
|
lacZ2210(Am) |
amber (UAG) mutation | ||||||
|
lacZ332(Fs) |
|||||||
|
lacZ4503(Am) |
amber (UAG) mutation | ||||||
|
lacZ49 |
|||||||
|
lacZ56 |
|||||||
|
lacZ131 |
|||||||
|
lacZ2246 |
|||||||
|
lacZ8(Am) |
amber (UAG) mutation | ||||||
|
lacZ59 |
|||||||
|
lacZ4502::Tn10 |
|||||||
|
lacZ4787(del)(::rrnB-3) |
|||||||
|
lacZ4796::Tn5 |
|||||||
|
lacZ536(Am) |
amber (UAG) mutation | ||||||
|
lacZ571(Am) |
amber (UAG) mutation | ||||||
|
lacZ8305::Mu cts62 |
|||||||
|
lacZ4525::Tn10kan |
|||||||
|
lacZ572 |
|||||||
|
lacZ574 |
|||||||
|
lacZ573 |
|||||||
|
lacZ575 |
|||||||
|
lacZ576 |
|||||||
|
lacZ1125 |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0335 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACCATGATTACGGATTCACT Primer 2:CCTTTTTGACACCAGACCAACTG | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: % [19] | ||
|
Linked marker |
est. P1 cotransduction: 87% [19] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Fowler, AV & Zabin, I (1978) Amino acid sequence of beta-galactosidase. VIII. Sequence of the NH2-terminal segment, CNBr peptides 1 to 9, residues 1 to 377. J. Biol. Chem. 253 5505-9 PubMed
- ↑ Fowler, AV & Zabin, I (1978) Amino acid sequence of beta-galactosidase. XI. Peptide ordering procedures and the complete sequence. J. Biol. Chem. 253 5521-5 PubMed
- ↑ 4.0 4.1 4.2 4.3 4.4 4.5 4.6 4.7 Newton, WA et al. (1965) Nonsense mutants and polarity in the lac operon of Escherichia coli. J. Mol. Biol. 14 290-6 PubMed
- ↑ Mandecki, W et al. (1981) Position of the lacZX90 mutation and hybridization between complete and incomplete beta-galactosidase. J. Bacteriol. 147 694-7 PubMed
- ↑ Zabin, I et al. (1978) Position of the mutation in beta-galactosidase ochre mutant U118. J. Bacteriol. 133 437-8 PubMed
- ↑ Epstein, W (1967) Transposition of the lac region of Escherichia coli. IV. Escape from repression in bacteriophage-carried lac genes. J. Mol. Biol. 30 529-43 PubMed
- ↑ 8.0 8.1 8.2 8.3 8.4 Zipser, D et al. (1970) Fine structure of the gradient of polarity in the z gene of the lac operon of Escherichia coli. J. Mol. Biol. 49 251-4 PubMed
- ↑ Hoess, RH & Herman, RK (1975) Isolation and characterization of mutator strains of Escherichia coli K-12. J. Bacteriol. 122 474-84 PubMed
- ↑ Normanly, J et al. (1990) Construction of Escherichia coli amber suppressor tRNA genes. III. Determination of tRNA specificity. J. Mol. Biol. 213 719-26 PubMed
- ↑ Foster, TJ (1977) Insertion of the tetracycline resistance translocation unit Tn10 in the lac operon of Escherichia coli K12. Mol. Gen. Genet. 154 305-9 PubMed
- ↑ Datsenko, KA & Wanner, BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97 6640-5 PubMed
- ↑ 13.0 13.1 13.2 13.3 13.4 13.5 Cupples, CG & Miller, JH (1989) A set of lacZ mutations in Escherichia coli that allow rapid detection of each of the six base substitutions. Proc. Natl. Acad. Sci. U.S.A. 86 5345-9 PubMed
- ↑ Bukhari, AI & Allet, B (1975) Plaque-forming lambda-Mu hybrids. Virology 63 30-9 PubMed
- ↑ Reddy, M & Gowrishankar, J (1997) Identification and characterization of ssb and uup mutants with increased frequency of precise excision of transposon Tn10 derivatives: nucleotide sequence of uup in Escherichia coli. J. Bacteriol. 179 2892-9 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 18.0 18.1 CGSC: The Coli Genetics Stock Center
- ↑ 19.0 19.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
