lacI:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
lacI |
---|---|
Mnemonic |
Lactose |
Synonyms |
ECK0342, b0345, JW0336[1], JW0336 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
7.88 minutes |
MG1655: 366734..365652 |
||
NC_012967: 340066..338984 |
||||
W3110 |
|
W3110: 366734..365652 |
||
DH10B: 1386177..1385095 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
365652 |
Edman degradation |
PMID:1107032[2] |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
lacI(del) (Keio:JW0336) |
deletion |
deletion |
|||||
lacIY282D |
Y282D |
(in T41 mutant) |
Strain variation; seeded from UniProt:P03023 | ||||
lacIY17H |
Y17H |
Broadening of specificity |
seeded from UniProt:P03023 | ||||
lacIR22N |
R22N |
Recognizes an operator variant |
seeded from UniProt:P03023 | ||||
lacI3042::Tn10 |
Insertion at 365,945 bp in MG1655 (NC_000913) |
adapted from Nichols et al.[8] |
Synonyms: lacI42::Tn10 nnnCAG18439 also carries lacZ118(0c) (CGSC). | ||||
lacI60 |
|||||||
lacI22 |
|||||||
lacI694(IS) |
|||||||
lacI203 |
|||||||
lacI100 |
|||||||
lacI4500::Tn10 |
|||||||
lacI3098::Tn10kan |
|||||||
lacI3042::Tn10 |
|||||||
lacI373 |
|||||||
lacI50(Fs) |
frameshift mutation | ||||||
lacI785(del)::kan |
| ||||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW0336 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAACCAGTAACGTTATACGA Primer 2:CCCTGCCCGCTTTCCAGTCGGGA | |
Kohara Phage |
|||
Linked marker |
est. P1 cotransduction: % [8] | ||
Linked marker |
est. P1 cotransduction: 83% [8] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Beyreuther, K et al. (1975) Amino-acid sequence of lac repressor from Escherichia coli. Isolation, sequence analysis and sequence assembly of tryptic peptides and cyanogen-bromide fragments. Eur. J. Biochem. 59 491-509 PubMed
- ↑ Platt, T et al. (1972) Translational restarts: AUG reinitiation of a lac repressor fragment. Proc. Natl. Acad. Sci. U.S.A. 69 897-901 PubMed
- ↑ Adler, K et al. (1972) How lac repressor binds to DNA. Nature 237 322-7 PubMed
- ↑ Platt, T et al. (1973) Lac repressor. Specific proteolytic destruction of the NH 2 -terminal region and loss of the deoxyribonucleic acid-binding activity. J. Biol. Chem. 248 110-21 PubMed
- ↑ 6.0 6.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 7.0 7.1 7.2 7.3 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 8.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 9.0 9.1 Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed