mhpC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
mhpC |
|---|---|
| Mnemonic |
m-Hydroxyphenylpropionic acid |
| Synonyms |
ECK0346, b0349, JW0340[1], JW0340 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
7.98 minutes |
MG1655: 370448..371329 |
||
|
NC_012967: 343780..344661 |
||||
|
W3110 |
|
W3110: 370448..371329 |
||
|
DH10B: 1389891..1390772 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
mhpC(del) (Keio:JW0340) |
deletion |
deletion |
|||||
|
mhpCR197K |
R197K |
40-fold and 5-fold decrease in catalytic activity and affinity, respectively |
seeded from UniProt:P77044 | ||||
|
mhpCR197Q |
R197Q |
280-fold and 10-fold decrease in catalytic activity and affinity, respectively |
seeded from UniProt:P77044 | ||||
|
mhpCS119A |
S119A |
Weakly active. 3-fold decrease in affinity. Fast ketonisation and slow C-C cleavage |
seeded from UniProt:P77044 | ||||
|
mhpCC270A |
C270A |
2-fold decrease in catalytic activity and almost 2-fold increase in affinity |
seeded from UniProt:P77044 | ||||
|
mhpCH272A |
H272A |
Weakly active, 1000-fold decrease in catalytic efficiency. Very slow ketonisation and C-C cleavage |
seeded from UniProt:P77044 | ||||
|
mhpCW273G |
W273G |
10-fold and 20-fold decrease in catalytic activity and affinity, respectively |
seeded from UniProt:P77044 | ||||
|
mhpCS119G |
S119G |
Weakly active. 3-fold decrease in affinity. Fast ketonisation and slow C-C cleavage |
seeded from UniProt:P77044 | ||||
|
mhpCH123A |
H123A |
More than 2-fold decrease in catalytic efficiency and 3-fold increase affinity |
seeded from UniProt:P77044 | ||||
|
mhpCS49A |
S49A |
2-fold decrease in catalytic efficiency and more than 5-fold increase in affinity for the natural substrate |
seeded from UniProt:P77044 | ||||
|
mhpCN118A |
N118A |
200-fold decrease in catalytic activity and almost 2-fold increase in affinity |
seeded from UniProt:P77044 | ||||
|
mhpCN118H |
N118H |
350-fold decrease in catalytic activity and almost 2-fold increase in affinity |
seeded from UniProt:P77044 | ||||
|
mhpCF182D |
F182D |
100-fold decrease in catalytic activity |
seeded from UniProt:P77044 | ||||
|
mhpCF182G |
F182G |
4-fold and 8-fold decrease in catalytic activity and affinity, respectively |
seeded from UniProt:P77044 | ||||
|
mhpC281::Tn10 |
Insertion at 371,180 bp in MG1655 (NC_000913) |
adapted from Nichols et al.[4] |
Synonyms: zah-281::Tn10 | ||||
|
mhpC281::Tn10 |
|||||||
|
ΔmhpC789::kan |
|||||||
|
MhpC H263A |
H263A |
Ser110, His263 and Asp235 compose the catalytic triad of MhpC, and mutation of His263 to Alanine causes a 10,000 fold reduction in Kcat for 2-hydroxy-6-keto-nona-1,9-dioic acid 5,6-hydrolase activity. |
|||||
|
MhpC Ser110A MhpC Ser110G |
Either: Ser110Ala or Ser110Gly |
Ser110, His263 and Asp235 compose the catalytic triad of MhpC, and mutation of Ser110 to Alanine or Glycine causes a 10,000 fold reduction in Kcat for 2-hydroxy-6-keto-nona-1,9-dioic acid 5,6-hydrolase activity. |
| ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0340 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCAGGAGAAGATGATGAGTTA Primer 2:CCAGGGCGTGCGAGGAAATTCAG | |
|
Linked marker |
est. P1 cotransduction: 88% [4] | ||
|
Linked marker |
est. P1 cotransduction: 41% [4] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 3.3 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 4.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed
- ↑ Nichols, BP et al. (1998) Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction. J. Bacteriol. 180 6408-11 PubMed
- ↑ 7.0 7.1 Li, C et al. (2005) Catalytic mechanism of C-C hydrolase MhpC from Escherichia coli: kinetic analysis of His263 and Ser110 site-directed mutants. J. Mol. Biol. 346 241-51 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
