kdsA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
kdsA |
---|---|
Gene Synonym(s) |
ECK1203, b1215, JW1206[1], JW1206 |
Product Desc. |
KdsA[2]; 3-deoxy-D-manno-octulosonate 8-phosphate synthase[3]; Component of [[:Category:Complex:3-deoxy-D-manno-octulosonic acid 8-phosphate synthase|3-deoxy-D-manno-octulosonic acid 8-phosphate synthase]][2]; [[:Category:Complex:3-deoxy-D-manno-octulosonic acid 8-phosphate synthase|3-deoxy-D-manno-octulosonate 8-phosphate synthase]][3] 3-deoxy-D-manno-octulosonate 8-phosphate (KDO8-P) synthase; LPS biosynthesis[4] |
Product Synonyms(s) |
3-deoxy-D-manno-octulosonate 8-phosphate synthase[1], B1215[2][1], KdsA[2][1] , ECK1203, JW1206, b1215 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression |
transcription unit(s): kdsA[2], ychQA-kdsA[2] |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
kdsA gutQ double mutants are non-viable and lack KDO; multicopy msbA, or unknown chromsomal mutation(s) in suppressed KDO-null strain KPM22, permit viabilty without KDO-containing LPS (Meredith, 2006).[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
kdsA |
---|---|
Mnemonic |
KDO synthesis |
Synonyms |
ECK1203, b1215, JW1206[1], JW1206 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
27.32 minutes |
MG1655: 1267388..1268242 |
||
NC_012967: 1268315..1269169 |
||||
NC_012759: 1156109..1156963 |
||||
W3110 |
|
W3110: 1269742..1270596 |
||
DH10B: 1307629..1308483 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
1267388 |
Edman degradation |
PMID:7775423 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW1206 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAAACAAAAAGTGGTTAGCAT Primer 2:CCCTTGCTGGTATCCAGTTCTTC | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 26% [6] | ||
Linked marker |
est. P1 cotransduction: 22% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10518 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10518 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000511 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0513 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004077 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
KdsA |
---|---|
Synonyms |
3-deoxy-D-manno-octulosonate 8-phosphate synthase[1], B1215[2][1], KdsA[2][1] , ECK1203, JW1206, b1215 |
Product description |
KdsA[2]; 3-deoxy-D-manno-octulosonate 8-phosphate synthase[3]; Component of [[:Category:Complex:3-deoxy-D-manno-octulosonic acid 8-phosphate synthase|3-deoxy-D-manno-octulosonic acid 8-phosphate synthase]][2]; [[:Category:Complex:3-deoxy-D-manno-octulosonic acid 8-phosphate synthase|3-deoxy-D-manno-octulosonate 8-phosphate synthase]][3] 3-deoxy-D-manno-octulosonate 8-phosphate (KDO8-P) synthase; LPS biosynthesis[4] |
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0005829 |
cytosol |
PMID:16858726 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0008676 |
3-deoxy-8-phosphooctulonate synthase activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00056 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008676 |
3-deoxy-8-phosphooctulonate synthase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006269 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008676 |
3-deoxy-8-phosphooctulonate synthase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:2.5.1.55 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0019294 |
keto-3-deoxy-D-manno-octulosonic acid biosynthetic process |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00056 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of [[:Category:Complex:3-deoxy-D-manno-octulosonic acid 8-phosphate synthase|3-deoxy-D-manno-octulosonic acid 8-phosphate synthase]] |
could be indirect |
||
Protein |
djlA |
PMID:16606699 |
Experiment(s):EBI-1139204 | |
Protein |
mdoD |
PMID:16606699 |
Experiment(s):EBI-1139204 | |
Protein |
groL |
PMID:16606699 |
Experiment(s):EBI-1139204 | |
Protein |
sdhA |
PMID:16606699 |
Experiment(s):EBI-1139204 | |
Protein |
groL |
PMID:15690043 |
Experiment(s):EBI-881294 | |
Protein |
rcsC |
PMID:15690043 |
Experiment(s):EBI-881294 | |
Protein |
hldD |
PMID:15690043 |
Experiment(s):EBI-881294 | |
Protein |
rplA |
PMID:15690043 |
Experiment(s):EBI-881294 | |
Protein |
rplS |
PMID:15690043 |
Experiment(s):EBI-881294, EBI-888757 | |
Protein |
rplV |
PMID:15690043 |
Experiment(s):EBI-881294, EBI-888757 | |
Protein |
rplX |
PMID:15690043 |
Experiment(s):EBI-881294, EBI-888757 | |
Protein |
rpsC |
PMID:15690043 |
Experiment(s):EBI-881294, EBI-888757 | |
Protein |
rpsM |
PMID:15690043 |
Experiment(s):EBI-881294 | |
Protein |
tufA |
PMID:15690043 |
Experiment(s):EBI-881294, EBI-888757 | |
Protein |
ybdN |
PMID:15690043 |
Experiment(s):EBI-881294 | |
Protein |
gyrA |
PMID:15690043 |
Experiment(s):EBI-881294 | |
Protein |
kdsB |
PMID:15690043 |
Experiment(s):EBI-881294 | |
Protein |
metK |
PMID:15690043 |
Experiment(s):EBI-881294 | |
Protein |
ypeA |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
hupA |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
murE |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rplC |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rplD |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rplE |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rplF |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rplI |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rplL |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rplM |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rplN |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rplY |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpmB |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpmG |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpsB |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpsD |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpsE |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpsG |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpsI |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpsJ |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpsK |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpsN |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpsT |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
yagG |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
yfiF |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
yihR |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rplU |
PMID:15690043 |
Experiment(s):EBI-888757 | |
Protein |
rpsN |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplE |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplX |
PMID:19402753 |
LCMS(ID Probability):99.0 MALDI(Z-score):12.154008 | |
Protein |
rpsI |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsM |
PMID:19402753 |
MALDI(Z-score):19.109181 | |
Protein |
rplU |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplS |
PMID:19402753 |
LCMS(ID Probability):99.0 MALDI(Z-score):15.027321 | |
Protein |
gyrA |
PMID:19402753 |
MALDI(Z-score):20.708604 | |
Protein |
rpsC |
PMID:19402753 |
LCMS(ID Probability):99.0 MALDI(Z-score):19.388132 | |
Protein |
hupA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplA |
PMID:19402753 |
MALDI(Z-score):18.777277 | |
Protein |
rfaD |
PMID:19402753 |
MALDI(Z-score):33.513134 | |
Protein |
ypeA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
murE |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
malP |
PMID:19402753 |
MALDI(Z-score):21.120618 | |
Protein |
lon |
PMID:19402753 |
MALDI(Z-score):24.937062 | |
Protein |
rplD |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):19.721490 | |
Protein |
ycbZ |
PMID:19402753 |
MALDI(Z-score):26.982999 | |
Protein |
yagG |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
yihR |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
Protein |
rplL |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
cytoplasm |
From EcoCyc[3] |
| ||
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MKQKVVSIGD INVANDLPFV LFGGMNVLES RDLAMRICEH YVTVTQKLGI PYVFKASFDK ANRSSIHSYR GPGLEEGMKI FQELKQTFGV KIITDVHEPS QAQPVADVVD VIQLPAFLAR QTDLVEAMAK TGAVINVKKP QFVSPGQMGN IVDKFKEGGN EKVILCDRGA NFGYDNLVVD MLGFSIMKKV SGNSPVIFDV THALQCRDPF GAASGGRRAQ VAELARAGMA VGLAGLFIEA HPDPEHAKCD GPSALPLAKL EPFLKQMKAI DDLVKGFEEL DTSK |
Length |
284 |
Mol. Wt |
30.832 kDa |
pI |
6.9 (calculated) |
Extinction coefficient |
5,960 - 6,460 (calc based on 4 Y, 0 W, and 4 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0004077 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10518 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10518 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000511 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0513 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
3.76E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
Ecoli K-12 |
94.955+/-0.41 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.151053864 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 EMG2 |
200 |
molecules/cell |
|
Quantitative protein sequencing |
Spot ID: M134 |
PMID: 9298646 |
Protein |
E. coli K-12 MG1655 |
6456 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
2596 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
3707 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1267368..1267408
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for kdsA | |
microarray |
Summary of data for kdsA from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to kdsA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10518 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0513 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10518 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000511 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004077 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
Shigella flexneri |
KDSA |
From SHIGELLACYC |
E. coli O157 |
KDSA |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10518 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10518 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000511 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0513 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004077 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories