gltA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
gltA |
|---|---|
| Mnemonic |
Glutamate |
| Synonyms |
ECK0709, b0720, JW0710, glut, icdB[1], gluT, icdB |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
16.22 minutes |
MG1655: 753691..752408 |
||
|
NC_012967: 735259..733976 |
||||
|
NC_012759: 655168..656451 |
||||
|
W3110 |
|
W3110: 754890..753607 |
||
|
DH10B: 806283..805000 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
752411 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
gltAC207S |
C207S |
Weakened NADH binding and inhibition |
seeded from UniProt:P0ABH7 | ||||
|
gltAE208A |
E208A |
Weakened NADH binding and inhibition |
seeded from UniProt:P0ABH7 | ||||
|
ΔgltA (Keio:JW0710) |
deletion |
deletion |
|||||
|
gltA::Tn5KAN-2 (FB20222) |
Insertion at nt 774 in Plus orientation |
does not contain pKD46 | |||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire Dextrin |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire N-Acetyl-D-glucosamine |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire D-Fructose |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire L-Fucose |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactose |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire Maltose |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire D-Mannitol |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire D-Mannose |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire b-Methyl-D-glucoside |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire D-Sorbitol |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire a-D-Glucose-1-phosphate |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire a-D-Glucose-6-phosphate |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire DL-a-Glycerol |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactoniate |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire D-Gluconate |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire D-Glucuronate |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire DL-Lactate |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire D-Serine |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire Inosine |
||||
|
ΔgltA::kan |
deletion |
Biolog:respiration |
unable to respire Uridine |
||||
|
gltA6 |
|||||||
|
gltA9 |
|||||||
|
gltA16 |
|||||||
|
gltA5 |
|||||||
|
gltA0 |
|||||||
|
ΔgltA770::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0710 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTGATACAAAAGCAAAACT Primer 2:CCACGCTTGATATCGCTTTTAAA | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 9% [10] | ||
|
Linked marker |
est. P1 cotransduction: 36% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Bhayana, V & Duckworth, HW (1984) Amino acid sequence of Escherichia coli citrate synthase. Biochemistry 23 2900-5 PubMed
- ↑ Rompf, A et al. (1998) Changes in protein synthesis as a consequence of heme depletion in Escherichia coli. Curr. Microbiol. 37 226-30 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 7.00 7.01 7.02 7.03 7.04 7.05 7.06 7.07 7.08 7.09 7.10 7.11 7.12 7.13 7.14 7.15 7.16 7.17 7.18 7.19 7.20 7.21 7.22 7.23 7.24 7.25 7.26 7.27 7.28 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
