ftsA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ftsA |
|---|---|
| Mnemonic |
Filamentation, temperature sensitive |
| Synonyms |
ECK0095, b0094, JW0092, divA[1], divA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
2.24 minutes |
MG1655: 103982..105244 |
||
|
NC_012967: 106786..108048 |
||||
|
NC_012759: 103981..105243 |
||||
|
W3110 |
|
W3110: 103982..105244 |
||
|
DH10B: 78086..79348 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
FtsA* |
R286W |
Growth Phenotype |
gain of function, can suppress cell division mutants, can compensate for a loss of ZipA Below normal levels of FtsZ, normal cell division is not permitted Cells are 27% shorter during exponential growth at 32C Enhances Z-ring assembly kinetics without increasing total levels of FtsZ |
suppressor of loss of zipA
| |||
|
ftsA1882(ts) |
Growth Phenotype |
forms small chains of swollen cells at 42 C; after a shift back to permissive temperature minicell-like cells are formed by the formation of aberrant constrictions |
part of AX621 strain | ||||
|
ftsA16(Am) |
Nonsense Mutation |
Growth Phenotype |
division stops after about 20 minutes at 42 C |
amber (UAG) mutation | |||
|
ftsA2(ts) |
temperature sensitive |
||||||
|
ftsA3(ts) |
temperature sensitive |
forms abortive septa | |||||
|
ftsA27(ts) |
temperature sensitive |
||||||
|
ftsA6 |
does not react to permissive temperature like other mutations | ||||||
|
ftsA12(ts) |
Growth Phenotype |
stops dividing at 42 C
|
|||||
|
ftsA12(ts) |
Cell Shape |
makes non-septated filaments at 42 C |
|||||
|
ftsA10 |
Growth Phenotype |
resistant to UV irradiation a temperature sensitive cell division mutant |
|||||
|
ftsA16(Am) |
Nonsense Mutation |
Cell Shape |
at 42 C indentations where septation would occur if grown at permissive temperature are seen |
amber (UAG) mutation | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0092 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATCAAGGCGACGGACAGAAA Primer 2:CCAAACTCTTTTCGCAGCCAACT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 47% [19] | |
|
Linked marker |
est. P1 cotransduction: 14% [19] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Geissler, B et al. (2003) A gain-of-function mutation in ftsA bypasses the requirement for the essential cell division gene zipA in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 100 4197-202 PubMed
- ↑ Geissler, B & Margolin, W (2005) Evidence for functional overlap among multiple bacterial cell division proteins: compensating for the loss of FtsK. Mol. Microbiol. 58 596-612 PubMed
- ↑ Bernard, CS et al. (2007) An altered FtsA can compensate for the loss of essential cell division protein FtsN in Escherichia coli. Mol. Microbiol. 64 1289-305 PubMed
- ↑ Geissler, B et al. (2007) The ftsA* gain-of-function allele of Escherichia coli and its effects on the stability and dynamics of the Z ring. Microbiology (Reading, Engl.) 153 814-25 PubMed
- ↑ Walker, JR et al. (1975) Regulation of bacterial cell division: temperature-sensitive mutants of Escherichia coli that are defective in septum formation. J. Bacteriol. 123 693-703 PubMed
- ↑ Allen, JS et al. (1974) Regulation of bacterial cell division: genetic and phenotypic analysis of temperature-sensitive, multinucleate, filament-forming mutants of Escherichia. J. Bacteriol. 117 978-86 PubMed
- ↑ Fletcher, G et al. (1978) Identification of the Escherichia coli cell division gene sep and organization of the cell division-cell envelope genes in the sep-mur-ftsA-envA cluster as determined with specialized transducing lambda bacteriophages. J. Bacteriol. 133 91-100 PubMed
- ↑ 9.0 9.1 Lutkenhaus, JF & Donachie, WD (1979) Identification of the ftsA gene product. J. Bacteriol. 137 1088-94 PubMed
- ↑ Tormo, A & Vicente, M (1984) The ftsA gene product participates in formation of the Escherichia coli septum structure. J. Bacteriol. 157 779-84 PubMed
- ↑ Taschner, PE et al. (1988) Division behavior and shape changes in isogenic ftsZ, ftsQ, ftsA, pbpB, and ftsE cell division mutants of Escherichia coli during temperature shift experiments. J. Bacteriol. 170 1533-40 PubMed
- ↑ 12.0 12.1 12.2 Dai, K et al. (1993) Cloning and characterization of ftsN, an essential cell division gene in Escherichia coli isolated as a multicopy suppressor of ftsA12(Ts). J. Bacteriol. 175 3790-7 PubMed
- ↑ 13.0 13.1 Cook, WR & Rothfield, LI (1994) Development of the cell-division site in FtsA- filaments. Mol. Microbiol. 14 497-503 PubMed
- ↑ VAN DE PUTTE, P et al. (1964) THE SELECTION OF MUTANTS OF ESCHERICHIA COLI WITH IMPAIRED CELL DIVISION AT ELEVATED TEMPERATURE. Mutat. Res. 106 121-8 PubMed
- ↑ Descoteaux, A & Drapeau, GR (1987) Regulation of cell division in Escherichia coli K-12: probable interactions among proteins FtsQ, FtsA, and FtsZ. J. Bacteriol. 169 1938-42 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 17.0 17.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 18.0 18.1 CGSC: The Coli Genetics Stock Center
- ↑ 19.0 19.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
