fnr:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
fnr |
|---|---|
| Mnemonic |
fumurate and nitrate reductase Fumarate and nitrate reduction |
| Synonyms | |
| edit table |
</protect>
Notes
The fnr gene was identified in 1976 by Lambden and Guest [3] who isolated mutants of E. coli K-12 that were unable to use fumarate as an anaerobic electron acceptor.
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
30.11 minutes |
MG1655: 1397550..1396798 |
||
|
NC_012967: 1396696..1395944 |
||||
|
NC_012759: 1287647..1288399 |
||||
|
W3110 |
|
W3110: 1401240..1400488 |
||
|
DH10B: 1486946..1486194 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1396798 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
fnr(del) (Keio:JW1328) |
deletion |
deletion |
|||||
|
fnrD154A,G,V |
D154A,G,V |
Loss of regulation by O(2) |
seeded from UniProt:P0A9E5 | ||||
|
fnr::Tn5KAN-I-SceI (FB20296) |
Insertion at nt 606 in Plus orientation |
does not contain pKD46 | |||||
|
fnrC16A |
C16A |
No effect |
published as fnr-382 seeded from UniProt:P0A9E5 | ||||
|
fnrC20S |
C20S |
Loss of activity |
published as fnr-197 seeded from UniProt:P0A9E5 | ||||
|
fnrD22G |
D22G |
Loss of regulation by O(2) |
seeded from UniProt:P0A9E5 | ||||
|
fnrS73F |
S73F |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrE64Q |
E64Q |
No effect |
seeded from UniProt:P0A9E5 | ||||
|
fnrR72H |
R72H |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrI81T |
I81T |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrG85A |
G85A |
Decrease in activity; no effect on DNA-binding. Trace activity; when associated with P-187 |
seeded from UniProt:P0A9E5 | ||||
|
fnrD86A |
D86A |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrE87K |
E87K |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrQ88E |
Q88E |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrH93R |
H93R |
Loss of regulation by O(2) |
seeded from UniProt:P0A9E5 | ||||
|
fnrG96D |
G96D |
Loss of activity |
seeded from UniProt:P0A9E5 | ||||
|
fnrT118A,P |
T118A,P |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrM120I,R,T,V |
M120I,R,T,V |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrC122A,S |
C122A,S |
Loss of activity |
seeded from UniProt:P0A9E5 | ||||
|
fnrR140A |
R140A |
Decrease in activity |
seeded from UniProt:P0A9E5 | ||||
|
fnrM143A |
M143A |
Decrease in activity |
seeded from UniProt:P0A9E5 | ||||
|
fnrM144A |
M144A |
Decrease in activity due to faulty dimerization |
seeded from UniProt:P0A9E5 | ||||
|
fnrR145A |
R145A |
Decrease in activity |
seeded from UniProt:P0A9E5 | ||||
|
fnrL146A |
L146A |
Decrease in activity |
seeded from UniProt:P0A9E5 | ||||
|
fnrM147A |
M147A |
Decrease in activity due to faulty dimerization |
seeded from UniProt:P0A9E5 | ||||
|
fnrE150K |
E150K |
Loss of regulation by O(2) |
seeded from UniProt:P0A9E5 | ||||
|
fnrT82P |
T82P |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrI151A |
I151A |
Decrease in activity due to faulty dimerization |
seeded from UniProt:P0A9E5 | ||||
|
fnrC29G |
C29G |
Loss of activity |
seeded from UniProt:P0A9E5 | ||||
|
fnrD43G |
D43G |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrI158A |
I158A |
Decrease in activity due to faulty dimerization |
seeded from UniProt:P0A9E5 | ||||
|
fnrF181L |
F181L |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrF186S |
F186S |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrS187P |
S187P |
Decrease in activity; no effect on DNA-binding. Trace activity; when associated with A-85 |
seeded from UniProt:P0A9E5 | ||||
|
fnrF191L |
F191L |
Decrease in activity; no effect on DNA-binding |
seeded from UniProt:P0A9E5 | ||||
|
fnrC23G |
C23G |
Loss of activity |
published as fnr-383 seeded from UniProt:P0A9E5 | ||||
|
fnrL28H |
L28H |
Loss of regulation by O(2) |
seeded from UniProt:P0A9E5 | ||||
|
fnr(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
D154A |
D154A |
Constitutive dimerization |
|||||
|
fnr-1 |
|||||||
|
fnr-25 |
|||||||
|
fnr-267(del) |
|||||||
|
fnr-771(del)::kan |
|||||||
|
fnr - |
Sensitivity to |
Mutants were sensitive to minimun 5 mM of chlorate. |
| ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1328 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATCCCGGAAAAGCGAATTAT Primer 2:CCGGCAACGTTACGCGTATGACC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 34% [14] | ||
|
Linked marker |
est. P1 cotransduction: 62% [14] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Lambden, PR & Guest, JR (1976) Mutants of Escherichia coli K12 unable to use fumarate as an anaerobic electron acceptor. J. Gen. Microbiol. 97 145-60 PubMed
- ↑ Trageser, M et al. (1990) Isolation of intact FNR protein (Mr 30,000) of Escherichia coli. Mol. Microbiol. 4 21-7 PubMed
- ↑ 5.0 5.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 8.0 8.1 8.2 Sharrocks, AD et al. (1990) In vivo and in vitro mutants of FNR the anaerobic transcriptional regulator of E. coli. FEBS Lett. 270 119-22 PubMed
- ↑ Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Moore, LJ et al. (2006) Regulation of FNR dimerization by subunit charge repulsion. J. Biol. Chem. 281 33268-75 PubMed
- ↑ Stewart, V & MacGregor, CH (1982) Nitrate reductase in Escherichia coli K-12: involvement of chlC, chlE, and chlG loci. J. Bacteriol. 151 788-99 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 13.0 13.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 14.0 14.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
