fabA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
fabA |
---|---|
Gene Synonym(s) |
ECK0945, b0954, JW0937[1], JW0937 |
Product Desc. |
3R-3-hydroxydecanoyl acyl carrier protein (ACP) dehydratase; also called beta-hydroxydecanoylthioester dehydrase[4] |
Product Synonyms(s) |
beta-hydroxydecanoyl thioester dehydrase[1], B0954[2][1], FabA[2][1] , ECK0945, JW0937, b0954 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Binds TrxA (Kumar, 2004).[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
fabA |
---|---|
Mnemonic |
Fatty acid biosynthesis |
Synonyms |
ECK0945, b0954, JW0937[1], JW0937 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
21.88 minutes |
MG1655: 1015693..1015175 |
||
NC_012967: 1033561..1033043 |
||||
NC_012759: 918143..918661 |
||||
W3110 |
|
W3110: 1016892..1016374 |
||
DH10B: 1069621..1069103 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
1015175 |
Edman degradation |
PMID:2832401 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
fabAP76L |
P76L |
(in allele FABA6; TS) |
Strain variation; seeded from UniProt:P0A6Q3 | ||||
fabAG102D |
G102D |
(in allele FABA2; TS) |
Strain variation; seeded from UniProt:P0A6Q3 | ||||
fabA18(ts) |
temperature sensitive |
||||||
fabA2(ts) |
temperature sensitive |
||||||
fabA203(p) |
PMID:6362720 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW0937 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGTAGATAAACGCGAATCCTA Primer 2:CCGAAGGCAGACGTATCCTGGAA | |
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 64% [6] | ||
Linked marker |
est. P1 cotransduction: 12% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10273 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10273 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000267 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0269 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0003229 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
FabA |
---|---|
Synonyms |
beta-hydroxydecanoyl thioester dehydrase[1], B0954[2][1], FabA[2][1] , ECK0945, JW0937, b0954 |
Product description |
3R-3-hydroxydecanoyl acyl carrier protein (ACP) dehydratase; also called beta-hydroxydecanoylthioester dehydrase[4] |
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0003824 |
catalytic activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000794 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00405 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010083 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006633 |
fatty acid biosynthetic process |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00405 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006633 |
fatty acid biosynthetic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010083 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006633 |
fatty acid biosynthetic process |
PMID:19679654 |
IGI: Inferred from Genetic Interaction |
UniProtKB:Q39473
|
P |
complete | ||
GO:0006633 |
fatty acid biosynthetic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0275 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008610 |
lipid biosynthetic process |
PMID:19679654 |
IGI: Inferred from Genetic Interaction |
UniProtKB:Q39473 EcoliWiki:fadD
|
P |
complete | ||
GO:0008610 |
lipid biosynthetic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0444 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008693 |
3-hydroxydecanoyl-(acyl-carrier-protein) dehydratase activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00405 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008693 |
3-hydroxydecanoyl-(acyl-carrier-protein) dehydratase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010083 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008693 |
3-hydroxydecanoyl-(acyl-carrier-protein) dehydratase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:4.2.1.60 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009058 |
biosynthetic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000794 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016829 |
lyase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0456 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of FABA-CPLX |
could be indirect |
||
Protein |
accA |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
ves |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
deaD |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
ffh |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
metK |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
rplA |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
rplB |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
rplS |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
rpsA |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
rpsB |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
rpsE |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
rpsG |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
rpsI |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
rpsM |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
tig |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
tufA |
PMID:15690043 |
Experiment(s):EBI-887293 | |
Protein |
hupA |
PMID:15690043 |
Experiment(s):EBI-893249 | |
Protein |
rpsR |
PMID:15690043 |
Experiment(s):EBI-893249 | |
Protein |
sucB |
PMID:16606699 |
Experiment(s):EBI-1138471 | |
Protein |
yfdS |
PMID:16606699 |
Experiment(s):EBI-1138471 | |
Protein |
ygeY |
PMID:16606699 |
Experiment(s):EBI-1138471 | |
Protein |
rpoC |
PMID:16606699 |
Experiment(s):EBI-1138471 | |
Protein |
lacZ |
PMID:16606699 |
Experiment(s):EBI-1138471 | |
Protein |
ybfC |
PMID:16606699 |
Experiment(s):EBI-1138471 | |
Protein |
ilvA |
PMID:16606699 |
Experiment(s):EBI-1138471 | |
Protein |
rpoB |
PMID:16606699 |
Experiment(s):EBI-1138471 | |
Protein |
rpsR |
PMID:19402753 |
LCMS(ID Probability):99.4 | |
Protein |
rplU |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsC |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
pflB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplK |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
gapA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
gadB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplB |
PMID:19402753 |
MALDI(Z-score):26.679973 | |
Protein |
rpsM |
PMID:19402753 |
MALDI(Z-score):27.146181 | |
Protein |
rpsF |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
hupA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpmB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
eno |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
ahpC |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsA |
PMID:19402753 |
MALDI(Z-score):27.129490 | |
Protein |
groS |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
metK |
PMID:19402753 |
MALDI(Z-score):30.362662 | |
Protein |
rplA |
PMID:19402753 |
MALDI(Z-score):28.482664 | |
Protein |
pgk |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
tig |
PMID:19402753 |
MALDI(Z-score):20.265244 | |
Protein |
ffh |
PMID:19402753 |
MALDI(Z-score):30.108857 | |
Protein |
fabB |
PMID:19402753 |
MALDI(Z-score):24.965065 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MVDKRESYTK EDLLASGRGE LFGAKGPQLP APNMLMMDRV VKMTETGGNF DKGYVEAELD INPDLWFFGC HFIGDPVMPG CLGLDAMWQL VGFYLGWLGG EGKGRALGVG EVKFTGQVLP TAKKVTYRIH FKRIVNRRLI MGLADGEVLV DGRLIYTASD LKVGLFQDTS AF |
Length |
172 |
Mol. Wt |
18.969 kDa |
pI |
6.5 (calculated) |
Extinction coefficient |
23,950 - 24,200 (calc based on 5 Y, 3 W, and 2 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0003229 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10273 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10273 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000267 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0269 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
2.34E+04 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
Ecoli K-12 |
610.512+/-6.309 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.507722008 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 MG1655 |
22820 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
4392 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
11905 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1015673..1015713
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for fabA | |
microarray |
Summary of data for fabA from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to fabA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10273 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0269 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10273 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000267 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0003229 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
Shigella flexneri |
FABA |
From SHIGELLACYC |
E. coli O157 |
FABA |
From ECOO157CYC |
edit table |
<protect></protect>
Notes
Families
<protect>
See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.
Database | Accession | Notes |
---|---|---|
| ||
edit table |
</protect> <protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories