{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	exbB
Gene Synonym(s)	ECK2999, b3006, JW2974^[1], JW2974
Product Desc.	ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins^[2]^[3]; Component of TonB energy transducing system^[3]; Outer Membrane Ferric Citrate Transport System^[3]; Outer Membrane Ferrichrome Transport System^[3]; Outer Membrane Ferric Enterobactin Transport System^[3]; vitamin B12 outer membrane transport complex^[3]; ferric dicitrate uptake system^[3]; ferrichrome uptake system^[3]; Ferric Enterobactin Transport System^[3]; vitamin B12 transport system^[3] Uptake of enterochelin; resistance or sensitivity to colicins; similarity with TolQ^[4]
Product Synonyms(s)	membrane spanning protein in TonB-ExbB-ExbD complex^[1], B3006^[2]^[1], ExbB^[2]^[1] , ECK2999, JW2974, b3006
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): exbBD^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	exbB
Mnemonic	Export
Synonyms	ECK2999, b3006, JW2974^[1], JW2974
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	67.88 minutes	MG1655: 3150006..3149272 <gbrowseImage> name=NC_000913:3149272..3150006 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 3086156..3085422 <gbrowseImage> name=NC_012967:3085422..3086156 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 3036420..3037154 <gbrowseImage> name=NC_012759:3036420..3037154 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3150640..3149906 <gbrowseImage> name=NC_007779:3149906..3150640 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 3247751..3247017 <gbrowseImage> name=NC_010473:3247017..3247751 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
exbB(del) (Keio:JW2974)	deletion	deletion			PMID:16738554	Shigen CGSC10285^[5]
exbB::Tn5KAN-I-SceI (FB21009)	Insertion at nt 111 in Plus orientation				PMID:15262929	E. coli Genome Project:FB21009	contains pKD46
exbB::Tn5KAN-I-SceI (FB21010)	Insertion at nt 111 in Plus orientation				PMID:15262929	E. coli Genome Project:FB21010	does not contain pKD46
exbB41						CGSC:8919
exbB779(del)::kan					PMID:16738554	CGSC:100764
ExbB^-			Resistant to	Resistant to several colicins and bacteriophage 80.	PMID:3309133		See page 3255
exbB in strain H1388 (pKE67)
exbB (pKE67)			Resistant to	Resistant to Albomycin	PMID:2670903	Strain: H1388	Table 3
exbB in strain P575			Resistant to	Tolerance to: Colicin B Colicin D colicin G Colicin H Colicin Ia Colicin Ib colicin M colicin S1	PMID:6433	Strain: P575	Table 5
exbB in strain P575			Resistant to	Partial tolerance to colicin V	PMID:6433	Strain: P575	Table 5
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW2974	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGGTAATAATTTAATGCAGAC Primer 2:CCTCCTGCGCGTAATTTTTGTGC
5C10	Kohara Phage	Genobase	PMID:3038334
6H4	Kohara Phage	Genobase	PMID:3038334
nupG511::Tn10	Linked marker	CAG18472 = CGSC7433^[5]	est. P1 cotransduction: 13% ^[6]
metC162::Tn10	Linked marker	CAG18475 = CGSC7435^[5]	est. P1 cotransduction: 97% ^[6]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10271	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10271	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000265	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945420	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0267	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009869	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	ExbB
Synonyms	membrane spanning protein in TonB-ExbB-ExbD complex^[1], B3006^[2]^[1], ExbB^[2]^[1] , ECK2999, JW2974, b3006
Product description	ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins^[2]^[3]; Component of TonB energy transducing system^[3]; Outer Membrane Ferric Citrate Transport System^[3]; Outer Membrane Ferrichrome Transport System^[3]; Outer Membrane Ferric Enterobactin Transport System^[3]; vitamin B12 outer membrane transport complex^[3]; ferric dicitrate uptake system^[3]; ferrichrome uptake system^[3]; Ferric Enterobactin Transport System^[3]; vitamin B12 transport system^[3] Uptake of enterochelin; resistance or sensitivity to colicins; similarity with TolQ^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0997	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002898	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0813	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008565	protein transporter activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002898	F	Seeded from EcoCyc (v14.0)	complete
	GO:0015031	protein transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0653	P	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002898	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0472	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0812	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-9909	C	Seeded from EcoCyc (v14.0)	complete
	GO:0043213	bacteriocin transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0080	P	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of TonB energy transducing system	could be indirect
Protein	rpmB		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rpsA		PMID:19402753^[7]	LCMS(ID Probability):98.5 MALDI(Z-score):32.748510
Protein	eno		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rpsP		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rpsN		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	gapA		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):35.305426
Protein	ahpC		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rpsF		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplR		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	groS		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):18.365315
Protein	yfiD		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	atpA		PMID:19402753^[7]	MALDI(Z-score):28.210375
Protein	rplK		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplU		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplI		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	fusA		PMID:19402753^[7]	MALDI(Z-score):25.260719
Protein	rfaD		PMID:19402753^[7]	LCMS(ID Probability):99.5 MALDI(Z-score):39.677095
Protein	hns		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	gadB		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):7.596208
Protein	gnd		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):9.140990
Protein	rpsJ		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	pstS		PMID:19402753^[7]	MALDI(Z-score):18.365093
Protein	pflB		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):27.960439
Protein	rplM		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	dnaJ		PMID:19402753^[7]	MALDI(Z-score):24.937705
Protein	hupB		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplB		PMID:19402753^[7]	LCMS(ID Probability):92.3 MALDI(Z-score):32.449290
Protein	infB		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):4.828399
Protein	hupA		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	dps		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	adhE		PMID:19402753^[7]	MALDI(Z-score):45.746765
Protein	clpB		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):26.333029
Protein	rplD		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	gpmA		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	malP		PMID:19402753^[7]	MALDI(Z-score):34.455115
Protein	rplW		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	nadC		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplY		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	phoA		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):4.715796
Protein	htpG		PMID:19402753^[7]	MALDI(Z-score):25.593506
Protein	cspC		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	nuoC		PMID:19402753^[7]	MALDI(Z-score):25.745725
Protein	purA		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	queA		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	ftsH		PMID:19402753^[7]	MALDI(Z-score):17.902344
Protein	pykF		PMID:19402753^[7]	MALDI(Z-score):23.175421
Protein	tnaA		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):26.481063
Protein	nuoE		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	kdgK		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	lysU		PMID:19402753^[7]	MALDI(Z-score):27.700815
Protein	nuoF		PMID:19402753^[7]	LCMS(ID Probability):98.5
Protein	otsA		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	hflX		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	Subunits of Outer Membrane Ferric Citrate Transport System	could be indirect
Protein	Subunits of Outer Membrane Ferrichrome Transport System	could be indirect
Protein	Subunits of Outer Membrane Ferric Enterobactin Transport System	could be indirect
Protein	Subunits of vitamin B12 outer membrane transport complex	could be indirect
Protein	Subunits of ferric dicitrate uptake system	could be indirect
Protein	Subunits of ferrichrome uptake system	could be indirect
Protein	Subunits of Ferric Enterobactin Transport System	could be indirect
Protein	Subunits of vitamin B12 transport system	could be indirect
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
plasma membrane	C-terminus localized in the cytoplasm with 3 predicted transmembrane domains	Daley et al. (2005) ^[8]
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MGNNLMQTDL SVWGMYQHAD IVVKCVMIGL ILASVVTWAI FFSKSVEFFN QKRRLKREQQ LLAEARSLNQ ANDIAADFGS KSLSLHLLNE AQNELELSEG SDDNEGIKER TSFRLERRVA AVGRQMGRGN GYLATIGAIS PFVGLFGTVW GIMNSFIGIA QTQTTNLAVV APGIAEALLA TAIGLVAAIP AVVIYNVFAR QIGGFKAMLG DVAAQVLLLQ SRDLDLEASA AAHPVRVAQK LRAG
Length	244
Mol. Wt	26.287 kDa
pI	8.3 (calculated)
Extinction coefficient	20,970 - 21,095 (calc based on 3 Y, 3 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	76..214	PF01618 MotA/TolQ/ExbB proton channel family		PMID:19920124^[9]
edit table

<motif_map/>

Click the image to view raw output from TMHMM.

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=exbB taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16130904	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945420	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009869	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0ABU7	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10271	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10271	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945420	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000265	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0267	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MC4100	6.64E+02	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI	PMID:18304323
Protein	E. coli K-12 MG1655	1995	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	777	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	695	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
exbBD
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:3149986..3150026 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3006 (EcoliWiki Page)	NCBI GEO profiles for exbB
microarray	GenExpDB:b3006 (EcoliWiki Page)	Summary of data for exbB from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to exbB Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10271	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0267	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3006
EcoGene	EcoGene:EG10271	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000265	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009869	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	EXBB	From SHIGELLACYC
E. coli O157	EXBB	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF01618 MotA/TolQ/ExbB proton channel family
EcoCyc	EcoCyc:EG10271	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10271	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000265	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0267	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009869	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.00 ^3.01 ^3.02 ^3.03 ^3.04 ^3.05 ^3.06 ^3.07 ^3.08 ^3.09 ^3.10 ^3.11 ^3.12 ^3.13 ^3.14 ^3.15 ^3.16 ^3.17 ^3.18 ^3.19 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^7.00 ^7.01 ^7.02 ^7.03 ^7.04 ^7.05 ^7.06 ^7.07 ^7.08 ^7.09 ^7.10 ^7.11 ^7.12 ^7.13 ^7.14 ^7.15 ^7.16 ^7.17 ^7.18 ^7.19 ^7.20 ^7.21 ^7.22 ^7.23 ^7.24 ^7.25 ^7.26 ^7.27 ^7.28 ^7.29 ^7.30 ^7.31 ^7.32 ^7.33 ^7.34 ^7.35 ^7.36 ^7.37 ^7.38 ^7.39 ^7.40 ^7.41 ^7.42 ^7.43 ^7.44 ^7.45 ^7.46 ^7.47 ^7.48 ^7.49 ^7.50 ^7.51 ^7.52 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed

exbB:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to exbB Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search