exbB:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
exbB |
|---|---|
| Gene Synonym(s) |
ECK2999, b3006, JW2974[1], JW2974 |
| Product Desc. |
ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins[2][3]; Component of TonB energy transducing system[3]; Outer Membrane Ferric Citrate Transport System[3]; Outer Membrane Ferrichrome Transport System[3]; Outer Membrane Ferric Enterobactin Transport System[3]; vitamin B12 outer membrane transport complex[3]; ferric dicitrate uptake system[3]; ferrichrome uptake system[3]; Ferric Enterobactin Transport System[3]; vitamin B12 transport system[3] Uptake of enterochelin; resistance or sensitivity to colicins; similarity with TolQ[4] |
| Product Synonyms(s) |
membrane spanning protein in TonB-ExbB-ExbD complex[1], B3006[2][1], ExbB[2][1] , ECK2999, JW2974, b3006 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
exbB |
|---|---|
| Mnemonic |
Export |
| Synonyms |
ECK2999, b3006, JW2974[1], JW2974 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
67.88 minutes |
MG1655: 3150006..3149272 |
||
|
NC_012967: 3086156..3085422 |
||||
|
NC_012759: 3036420..3037154 |
||||
|
W3110 |
|
W3110: 3150640..3149906 |
||
|
DH10B: 3247751..3247017 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
exbB(del) (Keio:JW2974) |
deletion |
deletion |
PMID:16738554 |
||||
|
exbB::Tn5KAN-I-SceI (FB21009) |
Insertion at nt 111 in Plus orientation |
PMID:15262929 |
contains pKD46 | ||||
|
exbB::Tn5KAN-I-SceI (FB21010) |
Insertion at nt 111 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
|
exbB41 |
|||||||
|
exbB779(del)::kan |
PMID:16738554 |
||||||
|
ExbB- |
Resistant to |
Resistant to several colicins and bacteriophage 80. |
PMID:3309133 |
See page 3255 | |||
|
exbB in strain H1388 (pKE67) |
|||||||
|
exbB (pKE67) |
Resistant to |
Resistant to Albomycin |
PMID:2670903 |
Strain: H1388 |
Table 3 | ||
|
exbB in strain P575 |
Resistant to |
Tolerance to:
|
PMID:6433 |
Strain: P575 |
Table 5 | ||
|
exbB in strain P575 |
Resistant to |
Partial tolerance to colicin V |
PMID:6433 |
Strain: P575 |
Table 5 | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2974 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGGTAATAATTTAATGCAGAC Primer 2:CCTCCTGCGCGTAATTTTTGTGC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 13% [6] | ||
|
Linked marker |
est. P1 cotransduction: 97% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10271 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10271 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000265 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0267 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0009869 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
ExbB |
|---|---|
| Synonyms |
membrane spanning protein in TonB-ExbB-ExbD complex[1], B3006[2][1], ExbB[2][1] , ECK2999, JW2974, b3006 |
| Product description |
ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins[2][3]; Component of TonB energy transducing system[3]; Outer Membrane Ferric Citrate Transport System[3]; Outer Membrane Ferrichrome Transport System[3]; Outer Membrane Ferric Enterobactin Transport System[3]; vitamin B12 outer membrane transport complex[3]; ferric dicitrate uptake system[3]; ferrichrome uptake system[3]; Ferric Enterobactin Transport System[3]; vitamin B12 transport system[3] Uptake of enterochelin; resistance or sensitivity to colicins; similarity with TolQ[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006810 |
transport |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002898 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006810 |
transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0008565 |
protein transporter activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002898 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015031 |
protein transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0653 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016020 |
membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002898 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0812 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9909 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0043213 |
bacteriocin transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0080 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of TonB energy transducing system |
could be indirect |
||
|
Protein |
rpmB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rpsA |
PMID:19402753 |
LCMS(ID Probability):98.5 MALDI(Z-score):32.748510 | |
|
Protein |
eno |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rpsP |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rpsN |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
gapA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):35.305426 | |
|
Protein |
ahpC |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rpsF |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rplR |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
groS |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):18.365315 | |
|
Protein |
yfiD |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
atpA |
PMID:19402753 |
MALDI(Z-score):28.210375 | |
|
Protein |
rplK |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rplU |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rplI |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
fusA |
PMID:19402753 |
MALDI(Z-score):25.260719 | |
|
Protein |
rfaD |
PMID:19402753 |
LCMS(ID Probability):99.5 MALDI(Z-score):39.677095 | |
|
Protein |
hns |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
gadB |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):7.596208 | |
|
Protein |
gnd |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):9.140990 | |
|
Protein |
rpsJ |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
pstS |
PMID:19402753 |
MALDI(Z-score):18.365093 | |
|
Protein |
pflB |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):27.960439 | |
|
Protein |
rplM |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
dnaJ |
PMID:19402753 |
MALDI(Z-score):24.937705 | |
|
Protein |
hupB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rplB |
PMID:19402753 |
LCMS(ID Probability):92.3 MALDI(Z-score):32.449290 | |
|
Protein |
infB |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):4.828399 | |
|
Protein |
hupA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
dps |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
adhE |
PMID:19402753 |
MALDI(Z-score):45.746765 | |
|
Protein |
clpB |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):26.333029 | |
|
Protein |
rplD |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
gpmA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
malP |
PMID:19402753 |
MALDI(Z-score):34.455115 | |
|
Protein |
rplW |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
nadC |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rplY |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
phoA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):4.715796 | |
|
Protein |
htpG |
PMID:19402753 |
MALDI(Z-score):25.593506 | |
|
Protein |
cspC |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
nuoC |
PMID:19402753 |
MALDI(Z-score):25.745725 | |
|
Protein |
purA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
queA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
ftsH |
PMID:19402753 |
MALDI(Z-score):17.902344 | |
|
Protein |
pykF |
PMID:19402753 |
MALDI(Z-score):23.175421 | |
|
Protein |
tnaA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):26.481063 | |
|
Protein |
nuoE |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
kdgK |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
lysU |
PMID:19402753 |
MALDI(Z-score):27.700815 | |
|
Protein |
nuoF |
PMID:19402753 |
LCMS(ID Probability):98.5 | |
|
Protein |
otsA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
hflX |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
Subunits of Outer Membrane Ferric Citrate Transport System |
could be indirect |
||
|
Protein |
Subunits of Outer Membrane Ferrichrome Transport System |
could be indirect |
||
|
Protein |
Subunits of Outer Membrane Ferric Enterobactin Transport System |
could be indirect |
||
|
Protein |
Subunits of vitamin B12 outer membrane transport complex |
could be indirect |
||
|
Protein |
Subunits of ferric dicitrate uptake system |
could be indirect |
||
|
Protein |
Subunits of ferrichrome uptake system |
could be indirect |
||
|
Protein |
Subunits of Ferric Enterobactin Transport System |
could be indirect |
||
|
Protein |
Subunits of vitamin B12 transport system |
could be indirect |
| |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
plasma membrane |
C-terminus localized in the cytoplasm with 3 predicted transmembrane domains |
Daley et al. (2005) [7] |
| |
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MGNNLMQTDL SVWGMYQHAD IVVKCVMIGL ILASVVTWAI FFSKSVEFFN QKRRLKREQQ LLAEARSLNQ ANDIAADFGS KSLSLHLLNE AQNELELSEG SDDNEGIKER TSFRLERRVA AVGRQMGRGN GYLATIGAIS PFVGLFGTVW GIMNSFIGIA QTQTTNLAVV APGIAEALLA TAIGLVAAIP AVVIYNVFAR QIGGFKAMLG DVAAQVLLLQ SRDLDLEASA AAHPVRVAQK LRAG |
| Length |
244 |
| Mol. Wt |
26.287 kDa |
| pI |
8.3 (calculated) |
| Extinction coefficient |
20,970 - 21,095 (calc based on 3 Y, 3 W, and 1 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0009869 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10271 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10271 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000265 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0267 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
6.64E+02 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
1995 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
777 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
695 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:3149986..3150026
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for exbB | |
|
microarray |
Summary of data for exbB from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to exbB Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10271 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0267 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10271 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000265 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0009869 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
EXBB |
From SHIGELLACYC |
|
E. coli O157 |
EXBB |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10271 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10271 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000265 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0267 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0009869 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 3.19 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
Categories



