envZ:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
envZ |
|---|---|
| Gene Synonym(s) | |
| Product Desc. |
Osmosensor histidine protein kinase/phosphatase; regulates production of outer membrane proteins; dimeric[4] |
| Product Synonyms(s) |
sensory histidine kinase in two-component regulatory system with OmpR[1], B3404[2][1], Tpo[2][1], Kmt[2][1], OmpB[2][1], PerA[2][1], EnvZ[2][1], osmolarity sensor kinase-phosphotransferase EnvZ[2][1], unphosphorylated osmolarity sensor kinase-phosphotransferase EnvZ[2][1], unmodified osmolarity sensor kinase-phosphotransferase EnvZ[2][1] , cpr, ECK3391, JW3367, ompB, perA, tpo, b3404 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
The cogate response regulator for EnvZ is OmpR.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
envZ |
|---|---|
| Mnemonic |
Envelope |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
76.14 minutes |
MG1655: 3533890..3532538 |
||
|
NC_012967: 3464552..3463200 |
||||
|
NC_012759: 3419695..3421047 |
||||
|
W3110 |
|
W3110: 4104548..4105900 |
||
|
DH10B: 3631635..3630283 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔenvZ (Keio:JW3367) |
deletion |
deletion |
PMID:16738554 |
||||
|
envZ::Tn5KAN-I-SceI (FB21166) |
Insertion at nt 295 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
|
envZ::Tn5KAN-I-SceI (FB21167) |
Insertion at nt 295 in Plus orientation |
PMID:15262929 |
contains pKD46 | ||||
|
envZA193L |
A193L |
Promotes the formation of alpha- helical secondary structure of the HAMP domain |
seeded from UniProt:P0AEJ4 | ||||
|
envZA193V |
A193V |
No effect |
seeded from UniProt:P0AEJ4 | ||||
|
envZN347D |
N347D |
Loss of ATP binding; loss of autophosphorylation |
seeded from UniProt:P0AEJ4 | ||||
|
envZ22 |
protein expression |
OmpC is not produced when grown in a minimal medium Incomplete OmpF repression during a shift to a medium of high-osmolarity |
PMID:2846509 PMID:6311806 |
||||
|
ΔenvZ738::kan |
PMID:16738554 |
||||||
|
envZ11 |
missense mutation |
Growth Phenotype |
lacks phosphatase activity that leads to overproduction of micF RNA and ompC mRNA leads to OmpF- OmpC-constitutive phenotype and results in cells that are LamB- PhoA- |
PMID:1695892 PMID:3536870 PMID:6799653 |
|||
|
envZ3 |
protein expression |
OmpC-/OmpF+ phenotype |
PMID:6311806 |
||||
|
envZ473 |
decreased transcription/ expression |
synthesis of envelope proteins including LamB, MalE, and PhoA is depressed due to decreased transcription of genes respective to the proteins porin gene ompF transcription is also reduced |
PMID:6311806 PMID:6799653 |
||||
|
envZ160 |
point mutation |
Leu-to-Gln at position 35 of the EnvZ protein |
protein expression |
has OmpF- OmpC-constitutive phenotype |
PMID:3536870 |
||
|
perA |
expression |
synthesis of alkaline phosphatase is significantly reduced effects phoA gene expression |
PMID:387722 |
perA is now a synonym for envZ and so it is assumed that this allele has been renamed | |||
|
tpo-11 |
Auxotrophies |
Mal - in maltose indicator augar. |
PMID:6997269 |
Experimental Strain: POP1263 Parental Strain: POP1010 |
|||
|
tpo-11 |
Growth Phenotype |
Slow growth. Strain has doubling time of 45 min, while WildType was 30 min in complete Medium. |
PMID:6997269 |
Experimental Strain: POP1263 Parental Strain: POP1267 |
|||
|
tpo-11 |
Growth Phenotype |
Slow growth. Strain has doubling time of 120 min, where wild type of 90 min in minimal (M63) glycerol. |
PMID:6997269 |
Experimental Strain: POP1263 Parental Strain: POP1267 |
|||
|
tpo-11 |
Resistant to |
Resistance to TP1 phage. |
PMID:6997269 |
Experimental Strain: POP1263 Parental Strain: POP1010 |
|||
|
tpo-11 |
Protein Synthesis |
Reduced amounts of ompF protein. |
PMID:6997269 |
Parental Strain: POP1386 Experimental Strain: POP1387 |
See figure 1 | ||
|
tpo-22 |
Protein Synthesis |
Reduced amount of ompF protein synthesis. |
PMID:6997269 |
Parental Strain: POP1386 Experimental Strain: POP1388 |
See figure 1. | ||
|
ompB101 |
Protein Synthesis |
Reduced amounts of ompF protein synthesis. |
PMID:6997269 |
Parental Strain: POP1386 Experimental Strain: POP1389 |
See Figure 1. | ||
|
tpo-11 |
Resistant to |
Resistance to lambda phage. |
PMID:6997269 |
Parental Strain: POP1010 Experimental strain: POP1263 |
In the absence of Maltose. See table 4. | ||
|
envZ in strain CE1115 |
Resistant to |
Resistant to Me1 phage. |
PMID:375003 |
Experimental Strain: CE1115 Parental Strain: PC0479 |
| ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3367 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAGGCGATTGCGCTTCTCGCC Primer 2:CCgCCTTCTTTTGTCGTGCCCTG | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 32% [6] | ||
|
Linked marker |
est. P1 cotransduction: 30% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000263 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0265 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0011108 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
EnvZ |
|---|---|
| Synonyms |
sensory histidine kinase in two-component regulatory system with OmpR[1], B3404[2][1], Tpo[2][1], Kmt[2][1], OmpB[2][1], PerA[2][1], EnvZ[2][1], osmolarity sensor kinase-phosphotransferase EnvZ[2][1], unphosphorylated osmolarity sensor kinase-phosphotransferase EnvZ[2][1], unmodified osmolarity sensor kinase-phosphotransferase EnvZ[2][1] , cpr, ECK3391, JW3367, ompB, perA, tpo, b3404 |
| Product description |
Osmosensor histidine protein kinase/phosphatase; regulates production of outer membrane proteins; dimeric[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0016310 |
phosphorylation |
PMID:2558046 |
IDA: Inferred from Direct Assay |
P |
Figure 1 |
complete | ||
|
GO:0000155 |
two-component sensor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003661 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000155 |
two-component sensor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005467 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000160 |
two-component signal transduction system (phosphorelay) |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0902 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000166 |
nucleotide binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0547 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004673 |
protein histidine kinase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005467 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004673 |
protein histidine kinase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:2.7.13.3 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004871 |
signal transducer activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003660 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004871 |
signal transducer activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR009082 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005524 |
ATP binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003594 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005524 |
ATP binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0067 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007165 |
signal transduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003660 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007165 |
signal transduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003661 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0046777 |
protein amino acid autophosphorylation |
PMID:2558046 |
IDA: Inferred from Direct Assay |
P |
Figure 1 |
complete | ||
|
GO:0007165 |
signal transduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005467 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007165 |
signal transduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR009082 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016020 |
membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003661 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000160 |
two-component signal transduction system (phosphorelay) |
PMID:2558046 |
IDA: Inferred from Direct Assay |
P |
with NRI- Figure 2 |
complete | ||
|
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006470 |
protein amino acid dephosphorylation |
PMID:2558046 |
IDA: Inferred from Direct Assay |
P |
dephosphorylates OmpR- Figure 7 |
complete | ||
|
GO:0016021 |
integral to membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003660 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0812 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9909 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016301 |
kinase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0418 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016310 |
phosphorylation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR004358 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016740 |
transferase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0808 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016772 |
transferase activity, transferring phosphorus-containing groups |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR004358 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0018106 |
peptidyl-histidine phosphorylation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005467 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of EnvZ |
could be indirect |
| |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
plasma membrane |
C-terminus localized in the cytoplasm with 2 predicted transmembrane domains |
Daley et al. (2005) [7] |
||
|
plasma membrane |
From EcoCyc[3] |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MRRLRFSPRS SFARTLLLIV TLLFASLVTT YLVVLNFAIL PSLQQFNKVL AYEVRMLMTD KLQLEDGTQL VVPPAFRREI YRELGISLYS NEAAEEAGLR WAQHYEFLSH QMAQQLGGPT EVRVEVNKSS PVVWLKTWLS PNIWVRVPLT EIHQGDFSPL FRYTLAIMLL AIGGAWLFIR IQNRPLVDLE HAALQVGKGI IPPPLREYGA SEVRSVTRAF NHMAAGVKQL ADDRTLLMAG VSHDLRTPLT RIRLATEMMS EQDGYLAESI NKDIEECNAI IEQFIDYLRT GQEMPMEMAD LNAVLGEVIA AESGYEREIE TALYPGSIEV KMHPLSIKRA VANMVVNAAR YGNGWIKVSS GTEPNRAWFQ VEDDGPGIAP EQRKHLFQPF VRGDSARTIS GTGLGLAIVQ RIVDNHNGML ELGTSERGGL SIRAWLPVPV TRAQGTTKEG |
| Length |
450 |
| Mol. Wt |
50.334 kDa |
| pI |
6.8 (calculated) |
| Extinction coefficient |
61,880 - 62,005 (calc based on 12 Y, 8 W, and 1 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0011108 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000263 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0265 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MG1655 |
159 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
43 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
82 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:3533870..3533910
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for envZ | |
|
microarray |
Summary of data for envZ from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to envZ Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0265 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000263 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0011108 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
ENVZ |
From SHIGELLACYC |
|
E. coli O157 |
ENVZ |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
||
|
EcoCyc:EG10269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000263 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0265 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0011108 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
Categories



