envZ:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
envZ |
|---|---|
| Mnemonic |
Envelope |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
76.14 minutes |
MG1655: 3533890..3532538 |
||
|
NC_012967: 3464552..3463200 |
||||
|
NC_012759: 3419695..3421047 |
||||
|
W3110 |
|
W3110: 4104548..4105900 |
||
|
DH10B: 3631635..3630283 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔenvZ (Keio:JW3367) |
deletion |
deletion |
|||||
|
envZ::Tn5KAN-I-SceI (FB21166) |
Insertion at nt 295 in Plus orientation |
does not contain pKD46 | |||||
|
envZ::Tn5KAN-I-SceI (FB21167) |
Insertion at nt 295 in Plus orientation |
contains pKD46 | |||||
|
envZA193L |
A193L |
Promotes the formation of alpha- helical secondary structure of the HAMP domain |
seeded from UniProt:P0AEJ4 | ||||
|
envZA193V |
A193V |
No effect |
seeded from UniProt:P0AEJ4 | ||||
|
envZN347D |
N347D |
Loss of ATP binding; loss of autophosphorylation |
seeded from UniProt:P0AEJ4 | ||||
|
envZ22 |
protein expression |
OmpC is not produced when grown in a minimal medium Incomplete OmpF repression during a shift to a medium of high-osmolarity |
|||||
|
ΔenvZ738::kan |
|||||||
|
envZ11 |
missense mutation |
Growth Phenotype |
lacks phosphatase activity that leads to overproduction of micF RNA and ompC mRNA leads to OmpF- OmpC-constitutive phenotype and results in cells that are LamB- PhoA- |
||||
|
envZ3 |
protein expression |
OmpC-/OmpF+ phenotype |
|||||
|
envZ473 |
decreased transcription/ expression |
synthesis of envelope proteins including LamB, MalE, and PhoA is depressed due to decreased transcription of genes respective to the proteins porin gene ompF transcription is also reduced |
|||||
|
envZ160 |
point mutation |
Leu-to-Gln at position 35 of the EnvZ protein |
protein expression |
has OmpF- OmpC-constitutive phenotype |
|||
|
perA |
expression |
synthesis of alkaline phosphatase is significantly reduced effects phoA gene expression |
perA is now a synonym for envZ and so it is assumed that this allele has been renamed | ||||
|
tpo-11 |
Auxotrophies |
Mal - in maltose indicator augar. |
Experimental Strain: POP1263 Parental Strain: POP1010 |
||||
|
tpo-11 |
Growth Phenotype |
Slow growth. Strain has doubling time of 45 min, while WildType was 30 min in complete Medium. |
Experimental Strain: POP1263 Parental Strain: POP1267 |
||||
|
tpo-11 |
Growth Phenotype |
Slow growth. Strain has doubling time of 120 min, where wild type of 90 min in minimal (M63) glycerol. |
Experimental Strain: POP1263 Parental Strain: POP1267 |
||||
|
tpo-11 |
Resistant to |
Resistance to TP1 phage. |
Experimental Strain: POP1263 Parental Strain: POP1010 |
||||
|
tpo-11 |
Protein Synthesis |
Reduced amounts of ompF protein. |
Parental Strain: POP1386 Experimental Strain: POP1387 |
See figure 1 | |||
|
tpo-22 |
Protein Synthesis |
Reduced amount of ompF protein synthesis. |
Parental Strain: POP1386 Experimental Strain: POP1388 |
See figure 1. | |||
|
ompB101 |
Protein Synthesis |
Reduced amounts of ompF protein synthesis. |
Parental Strain: POP1386 Experimental Strain: POP1389 |
See Figure 1. | |||
|
tpo-11 |
Resistant to |
Resistance to lambda phage. |
Parental Strain: POP1010 Experimental strain: POP1263 |
In the absence of Maltose. See table 4. | |||
|
envZ in strain CE1115 |
Resistant to |
Resistant to Me1 phage. |
Experimental Strain: CE1115 Parental Strain: PC0479 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3367 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGGCGATTGCGCTTCTCGCC Primer 2:CCgCCTTCTTTTGTCGTGCCCTG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 32% [16] | ||
|
Linked marker |
est. P1 cotransduction: 30% [16] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Forst, S et al. (1988) Regulation of ompC and ompF expression in Escherichia coli in the absence of envZ. J. Bacteriol. 170 5080-5 PubMed
- ↑ 7.0 7.1 7.2 Garrett, S et al. (1983) Isolation and characterization of chain-terminating nonsense mutations in a porin regulator gene, envZ. J. Bacteriol. 156 62-9 PubMed
- ↑ Coyer, J et al. (1990) micF RNA in ompB mutants of Escherichia coli: different pathways regulate micF RNA levels in response to osmolarity and temperature change. J. Bacteriol. 172 4143-50 PubMed
- ↑ 9.0 9.1 Matsuyama, S et al. (1986) Interaction between two regulatory proteins in osmoregulatory expression of ompF and ompC genes in Escherichia coli: a novel ompR mutation suppresses pleiotropic defects caused by an envZ mutation. J. Bacteriol. 168 1309-14 PubMed
- ↑ 10.0 10.1 Hall, MN & Silhavy, TJ (1981) Genetic analysis of the ompB locus in Escherichia coli K-12. J. Mol. Biol. 151 1-15 PubMed
- ↑ Wanner, BL et al. (1979) Escherichia coli pleiotropic mutant that reduces amounts of several periplasmic and outer membrane proteins. J. Bacteriol. 140 229-39 PubMed
- ↑ 12.0 12.1 12.2 12.3 12.4 12.5 12.6 12.7 Wandersman, C et al. (1980) Pleiotropic mutations rendering Escherichia coli K-12 resistant to bacteriophage TP1. J. Bacteriol. 143 1374-83 PubMed
- ↑ Verhoef, C et al. (1979) Genetics and biochemistry of the peptidoglycan-associated proteins b and c of Escherichia coli K12. Mol. Gen. Genet. 169 137-46 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 15.0 15.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 16.0 16.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
