{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	emrE
Gene Synonym(s)	ECK0534, b0543, JW0531, mvrC, eb, mvrB, G6299^[1]^[2]
Product Desc.	EmrE SMR transporter^[2]^[3] Multidrug resistance pump, DLP12 prophage; methylviologen sensitivity^[4]
Product Synonyms(s)	DLP12 prophage; multidrug resistance protein^[1], B0543^[2]^[1], MvrC^[2]^[1], EmrE^[2]^[1] , eb, ECK0534, JW0531, mvrC, b0543
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): renD^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

EmrE defunct PDB structures 1S7B and 2F2M, and any conclusions derived from these structures, have been retracted due to a software data inversion error (Ma, 2007; Chang, 2007). Correct structures are now available. EmrE belongs to the SMR efflux pump family, DMT superfamily. EmrE accomplishes multidrug efflux by coupling conformational changes between two heterodimers with proton gradient. Dual-topology membrane protein.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	emrE
Mnemonic	E.coli (or ethidium) multidrug resistance Efflux-multidrug resistance
Synonyms	ECK0534, b0543, JW0531, mvrC, eb, mvrB, G6299^[1]^[2]
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	12.23 minutes	MG1655: 567538..567870 <gbrowseImage> name=NC_000913:567538..567870 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 540205..540537 <gbrowseImage> name=NC_012967:540205..540537 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 470298..470630 <gbrowseImage> name=NC_012759:470298..470630 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 567538..567870 <gbrowseImage> name=NC_007779:567538..567870 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 506870..507202 <gbrowseImage> name=NC_010473:506870..507202 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
ΔemrE (Keio:JW0531)	deletion	deletion			PMID:16738554	Shigen CGSC8665^[5]
emrEE14C		E14C		No substrate binding. No transport activity. Resistance to toxicants is abolished			seeded from UniProt:P23895
emrEY4C		Y4C		Still binds substrate. No transport activity in the presence of a proton gradient, but still transports substrate in the absence of a proton gradient. Resistance to toxicants is abolished			seeded from UniProt:P23895
emrEW63C,Y		W63C,Y		No transport activity. Resistance to toxicants is abolished			seeded from UniProt:P23895
emrEW63F		W63F		Still binds substrate, with two- fold reduction in substrate affinity. Resistance to toxicants is abolished			seeded from UniProt:P23895
emrEY6C,F,L		Y6C,F,L		No effect on resistance to toxicants			seeded from UniProt:P23895
emrEY60C,F		Y60C,F		Still binds substrate, with lower affinity. Resistance to toxicants is abolished			seeded from UniProt:P23895
emrEL7C		L7C		No substrate binding. Resistance to toxicants is abolished			seeded from UniProt:P23895
emrEE14D		E14D		Still binds substrate. No transport activity in the presence of a proton gradient, but still transports substrate in the absence of a proton gradient. Resistance to toxicants is abolished			seeded from UniProt:P23895
emrEY53C		Y53C		No effect on resistance to toxicants			seeded from UniProt:P23895
emrEI11C		I11C		Still binds substrate, with lower affinity. Resistance to toxicants is abolished			seeded from UniProt:P23895
emrEA10C		A10C		Still binds substrate, with lower affinity. Resistance to toxicants is abolished			seeded from UniProt:P23895
emrEG17C		G17C		No substrate binding. Resistance to toxicants is abolished			seeded from UniProt:P23895
emrEY4F,W		Y4F,W		No effect on resistance to toxicants			seeded from UniProt:P23895
emrET18C		T18C		Still binds substrate, with lower affinity. Resistance to toxicants is abolished			seeded from UniProt:P23895
emrEY40C,F,L,M,S,T,V		Y40C,F,L,M,S,T,V		Modifies substrate specificity			seeded from UniProt:P23895
ΔemrE750::kan					PMID:16738554	CGSC:100704
mrvC in strain MC48			Resistant to	Resistance to Methyl Viologen	PMID:1320256	Strain MC48	Figure 2
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0531	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAACCCTTATATTTATCTTGG Primer 2:CCATGTGGTGTGCTTCGTGACAA
2C4	Kohara Phage	Genobase	PMID:3038334
23E10	Kohara Phage	Genobase	PMID:3038334
purK79::Tn10	Linked marker	CAG12171 = CGSC7342^[5]	est. P1 cotransduction: 58% ^[6] Synonyms:purE79::Tn10
dsbG601::Tn10	Linked marker	CAG12149 = CGSC7346^[5]	est. P1 cotransduction: 2% ^[6] Synonyms:zbd-601::Tn10, zbe-601::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10629	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10629	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000622	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948442	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0623	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001863	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	EmrE
Synonyms	DLP12 prophage; multidrug resistance protein^[1], B0543^[2]^[1], MvrC^[2]^[1], EmrE^[2]^[1] , eb, ECK0534, JW0531, mvrC, b0543
Product description	EmrE SMR transporter^[2]^[3] Multidrug resistance pump, DLP12 prophage; methylviologen sensitivity^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0006805	xenobiotic metabolic process	PMID:1320256	IMP: Inferred from Mutant Phenotype		P		complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0997	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	PMID:12356478	IDA: Inferred from Direct Assay		C		complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	PMID:12356478	IDA: Inferred from Direct Assay		P		complete
	GO:0006810	transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0813	P	Seeded from EcoCyc (v14.0)	complete
	GO:0042493	response to drug	PMID:7896833	IMP: Inferred from Mutant Phenotype		P		complete
	GO:0015297	antiporter activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0050	F	Seeded from EcoCyc (v14.0)	complete
	GO:0015297	antiporter activity	PMID:7896833	IDA: Inferred from Direct Assay		F		complete
	GO:0016021	integral to membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000390	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	PMID:9688273	IDA: Inferred from Direct Assay		C		complete
	GO:0016021	integral to membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0812	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-9909	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006974	response to DNA damage stimulus	PMID:11967071	IEP: Inferred from Expression Pattern		P		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	rpmB	PMID:19402753	LCMS(ID Probability):99.6
Protein	rpsT	PMID:19402753	LCMS(ID Probability):99.6
Protein	rplK	PMID:19402753	LCMS(ID Probability):99.6
Protein	fimA	PMID:19402753	LCMS(ID Probability):99.6
Protein	rplL	PMID:19402753	LCMS(ID Probability):99.6
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source
plasma membrane	C-terminus localized to the periplasm with 4 predicted transmembrane domains	Daley et al. (2005) ^[7]
plasma membrane			From EcoCyc^[3]
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MNPYIYLGGA ILAEVIGTTL MKFSEGFTRL WPSVGTIICY CASFWLLAQT LAYIPTGIAY AIWSGVGIVL ISLLSWGFFG QRLDLPAIIG MMLICAGVLI INLLSRSTPH
Length	110
Mol. Wt	11.958 kDa
pI	8.0 (calculated)
Extinction coefficient	29,450 - 29,825 (calc based on 5 Y, 4 W, and 3 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	2..94	PF00893 Small Multidrug Resistance protein		PMID:19920124
edit table

<motif_map/>

Click the image to view raw output from TMHMM.

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=emrE taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16128526	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948442	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001863	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P23895	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10629	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10629	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948442	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000622	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0623	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MG1655	510	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	142	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	196	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
renD
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:567518..567558 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0543 (EcoliWiki Page)	NCBI GEO profiles for emrE
microarray	GenExpDB:b0543 (EcoliWiki Page)	Summary of data for emrE from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (567399..567558) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ13; Well:F7^[8]
edit table

Notes

Accessions Related to emrE Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10629	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0623	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0543
EcoGene	EcoGene:EG10629	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000622	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001863	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	S4821	From SHIGELLACYC
E. coli O157	Z1870	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00893 Small Multidrug Resistance protein
Superfamily (EcoliWiki Page)	SUPERFAMILY:103481
EcoCyc	EcoCyc:EG10629	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10629	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000622	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0623	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001863	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 ^1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

emrE:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to emrE Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search