edd:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

edd

Gene Synonym(s)

ECK1852, b1851, JW1840[1], JW1840

Product Desc.

Phosphogluconate dehydratase; growth on gluconate[2]

Product Synonyms(s)

6-phosphogluconate dehydratase[1], B1851[3][1], Edd[3][1] , ECK1852, JW1840, b1851

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): edd-eda[3], OP00322

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]





Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

edd

Mnemonic

Entner-Douderoff dehydratase

Synonyms

ECK1852, b1851, JW1840[1], JW1840

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

41.62 minutes 

MG1655: 1932628..1930817
<gbrowseImage> name=NC_000913:1930817..1932628 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 1913180..1911369
<gbrowseImage> name=NC_012967:1911369..1913180 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 1822876..1824687
<gbrowseImage> name=NC_012759:1822876..1824687 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 1936318..1934507
<gbrowseImage> name=NC_007779:1934507..1936318 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 2023199..2021388
<gbrowseImage> name=NC_010473:2021388..2023199 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

edd(del) (Keio:JW1840)

deletion

deletion

PMID:16738554

Shigen

CGSC9536[4]

edd-1

CGSC:8107

edd-776(del)::kan

PMID:16738554

CGSC:100686

edd(del)

deletion

deletion

Colony Morphology

Mutations were non-motile after growth in LB and failed to spread on agar, figure 7.

PMID:16299298


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1840

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAATCCACAATTGTTACGCGT

Primer 2:CCAAAAGTGATACAGGTTGCGCC

eda-51::Tn10

Linked marker

CAG18486 = CGSC7392[4]

est. P1 cotransduction: 98% [5]

uvrC279::Tn10

Linked marker

CAG12156 = CGSC7394[4]

est. P1 cotransduction: 5% [5]

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10257

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10257

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000251

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946362

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0253

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0006166

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

Edd

Synonyms

6-phosphogluconate dehydratase[1], B1851[3][1], Edd[3][1] , ECK1852, JW1840, b1851

Product description

Phosphogluconate dehydratase; growth on gluconate[2]

EC number (for enzymes)

<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0005737

cytoplasm

C

Seeded from Riley et al 2006 [1].

Missing: evidence, reference

GO:0004456

phosphogluconate dehydratase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004786

F

Seeded from EcoCyc (v14.0)

complete

GO:0004456

phosphogluconate dehydratase activity

PMID:5337844

IMP: Inferred from Mutant Phenotype

F

complete

GO:0004456

phosphogluconate dehydratase activity

GOA:spec
GO_REF:0000003

IEA: Inferred from Electronic Annotation

EC:4.2.1.12

F

Seeded from EcoCyc (v14.0)

complete

GO:0008152

metabolic process

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000581

P

Seeded from EcoCyc (v14.0)

complete

GO:0008152

metabolic process

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR020558

P

Seeded from EcoCyc (v14.0)

complete

GO:0009255

Entner-Doudoroff pathway

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004786

P

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

nadE

PMID:16606699

Experiment(s):EBI-1141023

Protein

yejH

PMID:16606699

Experiment(s):EBI-1141023

Protein

rpsB

PMID:16606699

Experiment(s):EBI-1141023

Protein

aroA

PMID:16606699

Experiment(s):EBI-1141023

Protein

ansA

PMID:16606699

Experiment(s):EBI-1141023

Protein

slyD

PMID:16606699

Experiment(s):EBI-1141023

Protein

hdeA

PMID:19402753

LCMS(ID Probability):99.6

Protein

rho

PMID:19402753

LCMS(ID Probability):99.6

Protein

tig

PMID:19402753

LCMS(ID Probability):99.6

Protein

acnA

PMID:19402753

LCMS(ID Probability):99.6

Protein

cho

PMID:19402753

LCMS(ID Probability):99.6

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MNPQLLRVTN RIIERSRETR SAYLARIEQA KTSTVHRSQL ACGNLAHGFA ACQPEDKASL
KSMLRNNIAI ITSYNDMLSA HQPYEHYPEI IRKALHEANA VGQVAGGVPA MCDGVTQGQD
GMELSLLSRE VIAMSAAVGL SHNMFDGALF LGVCDKIVPG LTMAALSFGH LPAVFVPSGP
MASGLPNKEK VRIRQLYAEG KVDRMALLES EAASYHAPGT CTFYGTANTN QMVVEFMGMQ
LPGSSFVHPD SPLRDALTAA AARQVTRMTG NGNEWMPIGK MIDEKVVVNG IVALLATGGS
TNHTMHLVAM ARAAGIQINW DDFSDLSDVV PLMARLYPNG PADINHFQAA GGVPVLVREL
LKAGLLHEDV NTVAGFGLSR YTLEPWLNNG ELDWREGAEK SLDSNVIASF EQPFSHHGGT
KVLSGNLGRA VMKTSAVPVE NQVIEAPAVV FESQHDVMPA FEAGLLDRDC VVVVRHQGPK
ANGMPELHKL MPPLGVLLDR CFKIALVTDG RLSGASGKVP SAIHVTPEAY DGGLLAKVRD
GDIIRVNGQT GELTLLVDEA ELAAREPHIP DLSASRVGTG RELFSALREK LSGAEQGATC ITF
Length

603

Mol. Wt

64.638 kDa

pI

6.4 (calculated)

Extinction coefficient

36,900 - 37,900 (calc based on 10 Y, 4 W, and 8 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

65..598

PF00920 Dehydratase family

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=edd taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16129804

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:946362

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0006166

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P0ADF6

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG10257

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10257

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:946362

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000251

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0253

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

Ecoli K-12

16.906+/-0.181

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

Single Molecule Fluorescence

PMID:20671182

mRNA

Ecoli K-12

0.053561568

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

by RNA_Seq

PMID:20671182

Protein

E. coli K-12 MG1655

148

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

80

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

88

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

edd-eda

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:1932608..1932648 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b1851 (EcoliWiki Page)

NCBI GEO profiles for edd

microarray

GenExpDB:b1851 (EcoliWiki Page)

Summary of data for edd from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (1932554..1932891) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ01; Well:G3[6]

<protect></protect>

Notes

Accessions Related to edd Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10257

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0253

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b1851

EcoGene

EcoGene:EG10257

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000251

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0006166

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Xenopus tropicalis

  • ENSXETP00000034954 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Shigella flexneri

EDD

From SHIGELLACYC

E. coli O157

EDD

From ECOO157CYC


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF00920 Dehydratase family

Superfamily (EcoliWiki Page)

SUPERFAMILY:52016

Superfamily (EcoliWiki Page)

SUPERFAMILY:143975

EcoCyc

EcoCyc:EG10257

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10257

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000251

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0253

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0006166

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  3. 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  6. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

Categories

[back to top]