dnaG:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dnaG |
|---|---|
| Mnemonic |
DNA |
| Synonyms |
ECK3056, b3066, JW3038, dnaP, parB, sdgA[1], sdgA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
69.17 minutes |
MG1655: 3209129..3210874 |
||
|
NC_012967: 3143924..3145669 |
||||
|
NC_012759: 3096277..3098022 |
||||
|
W3110 |
|
W3110: 3209763..3211508 |
||
|
DH10B: 3306874..3308619 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3209132 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔdnaG (Keio:JW3038) |
deletion |
deletion |
|||||
|
dnaG::Tn5KAN-I-SceI (FB21017) |
Insertion at nt 798 in Plus orientation |
does not contain pKD46 | |||||
|
dnaG18 |
|||||||
|
dnaG3(ts) |
temperature sensitive |
||||||
|
dnaG308(ts) |
temperature sensitive |
||||||
|
dnaG399(ts) |
temperature sensitive |
||||||
|
dnaG2903 |
Growth Phenotype |
phage gamma could not multiply at 42C; TS revertants were spontaneously produced at high frequency; at high temperatures, cell growth and DNA replication is halted |
previously named dnaP18 | ||||
| edit table |
<protect></protect>
Notes
The Keio collection[3] lists a deletion of dnaG. The insertion in this strain is a duplication of the dnaG region.[7]
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3038 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTGGACGAATCCCACGCGT Primer 2:CCtTTTTTCGCCAGCTCCTGGTT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 30% [11] | ||
|
Linked marker |
est. P1 cotransduction: 81% [11] | ||
|
pGNG1 |
Plasmid Clone |
||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Smiley, BL et al. (1982) Sequences of the Escherichia coli dnaG primase gene and regulation of its expression. Proc. Natl. Acad. Sci. U.S.A. 79 4550-4 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Norris, V et al. (1986) DNA replication termination in Escherichia coli parB (a dnaG allele), parA, and gyrB mutants affected in DNA distribution. J. Bacteriol. 168 494-504 PubMed
- ↑ 6.0 6.1 Murakami, Y et al. (1985) Novel dnaG mutation in a dnaP mutant of Escherichia coli. J. Bacteriol. 162 830-2 PubMed
- ↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 CGSC: The Coli Genetics Stock Center
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Godson, GN (1991) An over-expression plasmid for Escherichia coli primase. Gene 100 59-64 PubMed
