cyoC:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
cyoC |
---|---|
Gene Synonym(s) |
ECK0424, b0430, JW0420[1], JW0420 |
Product Desc. |
cytochrome bo terminal oxidase subunit III[2][3]; Component of [[:Category:Complex:cytochrome bo terminal oxidase|cytochrome bo terminal oxidase]][2][3] Cytochrome o oxidase subunit III; cytochrome bo(3) ubiquinol oxidase subunit III[4] |
Product Synonyms(s) |
cytochrome o ubiquinol oxidase subunit III[1], B0430[2][1], CyoC[2][1] , ECK0424, JW0420, b0430 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
cyoC |
---|---|
Mnemonic |
Cytochrome o oxidase |
Synonyms |
ECK0424, b0430, JW0420[1], JW0420 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
9.64 minutes |
MG1655: 447884..447270 |
||
NC_012967: 419363..418749 |
||||
NC_012759: 350029..350643 |
||||
W3110 |
|
W3110: 447884..447270 |
||
DH10B: 387215..386601 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
cyoC(del) (Keio:JW0420) |
deletion |
deletion |
PMID:16738554 |
||||
cyoC::Tn5KAN-2 (FB20171) |
Insertion at nt 544 in Minus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
cyoC(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
PMID:16095938 |
|||
cyoC787(del)::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW0420 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGCAACTGATACTTTGACGCA Primer 2:CCCATCGCCCCCATCAGATAAAC | |
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 57% [6] | ||
Linked marker |
est. P1 cotransduction: 66% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10180 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10180 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000175 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0177 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0001491 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
CyoC |
---|---|
Synonyms |
cytochrome o ubiquinol oxidase subunit III[1], B0430[2][1], CyoC[2][1] , ECK0424, JW0420, b0430 |
Product description |
cytochrome bo terminal oxidase subunit III[2][3]; Component of [[:Category:Complex:cytochrome bo terminal oxidase|cytochrome bo terminal oxidase]][2][3] Cytochrome o oxidase subunit III; cytochrome bo(3) ubiquinol oxidase subunit III[4] |
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0004129 |
cytochrome-c oxidase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000298 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004129 |
cytochrome-c oxidase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013833 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014206 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006123 |
mitochondrial electron transport, cytochrome c to oxygen |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000298 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006810 |
transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009055 |
electron carrier activity |
PMID:3301837 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0009060 |
aerobic respiration |
PMID:2981797 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0009486 |
cytochrome bo3 ubiquinol oxidase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012141 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009486 |
cytochrome bo3 ubiquinol oxidase activity |
PMID:1322173 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0015453 |
oxidoreduction-driven active transmembrane transporter activity |
PMID:7961841 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0016020 |
membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000298 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016020 |
membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013833 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016021 |
integral to membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0812 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016021 |
integral to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9909 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0022900 |
electron transport chain |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0249 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0022904 |
respiratory electron transport chain |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013833 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014206 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of [[:Category:Complex:cytochrome bo terminal oxidase|cytochrome bo terminal oxidase]] |
could be indirect |
||
Protein |
groS |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
hupA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplI |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
yfiD |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
acpP |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
fimA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
yccJ |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
hdeA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsJ |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
dps |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
plasma membrane |
C-terminus localized to the periplasm with 5 predicted transmembrane domains |
Daley et al. (2005) [7] |
| |
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MATDTLTHAT AHAHEHGHHD AGGTKIFGFW IYLMSDCILF SILFATYAVL VNGTAGGPTG KDIFELPFVL VETFLLLFSS ITYGMAAIAM YKNNKSQVIS WLALTWLFGA GFIGMEIYEF HHLIVNGMGP DRSGFLSAFF ALVGTHGLHV TSGLIWMAVL MVQIARRGLT STNRTRIMCL SLFWHFLDVV WICVFTVVYL MGAM |
Length |
204 |
Mol. Wt |
22.622 kDa |
pI |
7.1 (calculated) |
Extinction coefficient |
41,940 - 42,315 (calc based on 6 Y, 6 W, and 3 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0001491 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10180 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10180 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000175 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0177 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
Ecoli K-12 |
46.768+/-0.432 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.417752443 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 MG1655 |
14872 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
2749 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
5041 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:447864..447904
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for cyoC | |
microarray |
Summary of data for cyoC from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to cyoC Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10180 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0177 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10180 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000175 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0001491 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Apis mellifera |
|
From Inparanoid:20070104 |
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
Danio rerio |
|
From Inparanoid:20070104 |
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
Gallus gallus |
|
From Inparanoid:20070104 |
Homo sapiens |
|
From Inparanoid:20070104 |
Mus musculus |
|
From Inparanoid:20070104 |
Oryza gramene |
|
From Inparanoid:20070104 |
Rattus norvegicus |
|
From Inparanoid:20070104 |
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
Shigella flexneri |
CYOC |
From SHIGELLACYC |
E. coli O157 |
CYOC |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10180 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10180 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000175 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0177 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0001491 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
Categories
- TMHMM Prediction
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Danio rerio
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Gallus gallus
- Genes with homologs in Homo sapiens
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Saccharomyces cerevisiae
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157