{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	cyoC
Gene Synonym(s)	ECK0424, b0430, JW0420^[1], JW0420
Product Desc.	cytochrome bo terminal oxidase subunit III^[2]^[3]; Component of [[:Category:Complex:cytochrome bo terminal oxidase\|cytochrome bo terminal oxidase]]^[2]^[3] Cytochrome o oxidase subunit III; cytochrome bo(3) ubiquinol oxidase subunit III^[4]
Product Synonyms(s)	cytochrome o ubiquinol oxidase subunit III^[1], B0430^[2]^[1], CyoC^[2]^[1] , ECK0424, JW0420, b0430
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): cyoABCDE^[2], OP00141
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	cyoC
Mnemonic	Cytochrome o oxidase
Synonyms	ECK0424, b0430, JW0420^[1], JW0420
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	9.64 minutes	MG1655: 447884..447270 <gbrowseImage> name=NC_000913:447270..447884 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 419363..418749 <gbrowseImage> name=NC_012967:418749..419363 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 350029..350643 <gbrowseImage> name=NC_012759:350029..350643 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 447884..447270 <gbrowseImage> name=NC_007779:447270..447884 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 387215..386601 <gbrowseImage> name=NC_010473:386601..387215 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
cyoC(del) (Keio:JW0420)	deletion	deletion			PMID:16738554	Shigen CGSC8584^[5]
cyoC::Tn5KAN-2 (FB20171)	Insertion at nt 544 in Minus orientation				PMID:15262929	E. coli Genome Project:FB20171	does not contain pKD46
cyoC(del)::kan	deletion		Biolog:respiration	unable to respire L-Alanine	PMID:16095938
cyoC787(del)::kan					PMID:16738554	CGSC:100476
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0420	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGCAACTGATACTTTGACGCA Primer 2:CCCATCGCCCCCATCAGATAAAC
2H5	Kohara Phage	Genobase	PMID:3038334
tsx-247::Tn10	Linked marker	CAG12148 = CGSC7337^[5]	est. P1 cotransduction: 57% ^[6]
zaj-3054::Tn10	Linked marker	CAG12017 = CGSC7339^[5]	est. P1 cotransduction: 66% ^[6] Synonyms:zba-3054::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10180	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10180	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000175	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:946897	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0177	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001491	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	CyoC
Synonyms	cytochrome o ubiquinol oxidase subunit III^[1], B0430^[2]^[1], CyoC^[2]^[1] , ECK0424, JW0420, b0430
Product description	cytochrome bo terminal oxidase subunit III^[2]^[3]; Component of [[:Category:Complex:cytochrome bo terminal oxidase\|cytochrome bo terminal oxidase]]^[2]^[3] Cytochrome o oxidase subunit III; cytochrome bo(3) ubiquinol oxidase subunit III^[4]
EC number (for enzymes)	1.10.3.-^[1]
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0004129	cytochrome-c oxidase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000298	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004129	cytochrome-c oxidase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR013833	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR014206	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0997	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006123	mitochondrial electron transport, cytochrome c to oxygen	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000298	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0813	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009055	electron carrier activity	PMID:3301837	IDA: Inferred from Direct Assay		F	Seeded from EcoCyc (v14.0)	complete
	GO:0009060	aerobic respiration	PMID:2981797	IMP: Inferred from Mutant Phenotype		P	Seeded from EcoCyc (v14.0)	complete
	GO:0009486	cytochrome bo3 ubiquinol oxidase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR012141	F	Seeded from EcoCyc (v14.0)	complete
	GO:0009486	cytochrome bo3 ubiquinol oxidase activity	PMID:1322173	IDA: Inferred from Direct Assay		F	Seeded from EcoCyc (v14.0)	complete
	GO:0015453	oxidoreduction-driven active transmembrane transporter activity	PMID:7961841	IDA: Inferred from Direct Assay		F	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000298	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR013833	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0472	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0812	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-9909	C	Seeded from EcoCyc (v14.0)	complete
	GO:0022900	electron transport chain	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0249	P	Seeded from EcoCyc (v14.0)	complete
	GO:0022904	respiratory electron transport chain	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR013833	P	Seeded from EcoCyc (v14.0)	complete
	GO:0055114	oxidation reduction	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR014206	P	Seeded from EcoCyc (v14.0)	complete
	GO:0055114	oxidation reduction	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0560	P	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of [[:Category:Complex:cytochrome bo terminal oxidase\|cytochrome bo terminal oxidase]]	could be indirect
Protein	groS		PMID:19402753	LCMS(ID Probability):99.6
Protein	hupA		PMID:19402753	LCMS(ID Probability):99.6
Protein	rplI		PMID:19402753	LCMS(ID Probability):99.6
Protein	yfiD		PMID:19402753	LCMS(ID Probability):99.6
Protein	acpP		PMID:19402753	LCMS(ID Probability):99.6
Protein	fimA		PMID:19402753	LCMS(ID Probability):99.6
Protein	yccJ		PMID:19402753	LCMS(ID Probability):99.6
Protein	hdeA		PMID:19402753	LCMS(ID Probability):99.6
Protein	rpsJ		PMID:19402753	LCMS(ID Probability):99.6
Protein	dps		PMID:19402753	LCMS(ID Probability):99.6
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
plasma membrane	C-terminus localized to the periplasm with 5 predicted transmembrane domains	Daley et al. (2005) ^[7]
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MATDTLTHAT AHAHEHGHHD AGGTKIFGFW IYLMSDCILF SILFATYAVL VNGTAGGPTG KDIFELPFVL VETFLLLFSS ITYGMAAIAM YKNNKSQVIS WLALTWLFGA GFIGMEIYEF HHLIVNGMGP DRSGFLSAFF ALVGTHGLHV TSGLIWMAVL MVQIARRGLT STNRTRIMCL SLFWHFLDVV WICVFTVVYL MGAM
Length	204
Mol. Wt	22.622 kDa
pI	7.1 (calculated)
Extinction coefficient	41,940 - 42,315 (calc based on 6 Y, 6 W, and 3 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	4..203	PF00510 Cytochrome c oxidase subunit III		PMID:19920124
edit table

<motif_map/>

Click the image to view raw output from TMHMM.

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=cyoC taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16128415	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:946897	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001491	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0ABJ3	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10180	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10180	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:946897	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000175	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0177	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	Ecoli K-12	46.768+/-0.432	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.417752443	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	14872	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	2749	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	5041	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
cyoABCDE
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:447864..447904 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0430 (EcoliWiki Page)	NCBI GEO profiles for cyoC
microarray	GenExpDB:b0430 (EcoliWiki Page)	Summary of data for cyoC from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to cyoC Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10180	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0177	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0430
EcoGene	EcoGene:EG10180	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000175	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001491	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Apis mellifera	ENSAPMP00000034166 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Arabidopsis thaliana	AT2G07687 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00010962 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-011205-16 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0201585 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000028435 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Homo sapiens	ENSP00000354982 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Mus musculus	MGI:102502 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Oryza gramene	P15953 (score: 1.000; bootstrap: 100%) Q9G721 (score: 0.994) Q8HCR6 (score: 0.930) Q6R9A2 (score: 0.924) P14852 (score: 0.924) Q36952 (score: 0.920) Q8HNK2 (score: 0.916) P09138 (score: 0.910)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000051326 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Saccharomyces cerevisiae	Q0275 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPMIT4 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	CYOC	From SHIGELLACYC
E. coli O157	CYOC	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00510 Cytochrome c oxidase subunit III
Panther (EcoliWiki Page)	PTHR11403:SF0
Superfamily (EcoliWiki Page)	SUPERFAMILY:81452
EcoCyc	EcoCyc:EG10180	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10180	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000175	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0177	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001491	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed

cyoC:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to cyoC Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search