tsx:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
tsx |
|---|---|
| Mnemonic |
T-six |
| Synonyms |
ECK0405, b0411, JW0401, T6rec, nupA[1], nupA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
9.28 minutes |
MG1655: 431237..430353 |
||
|
NC_012967: 400435..399662 |
||||
|
NC_012759: 333112..333996 |
||||
|
W3110 |
|
W3110: 431237..430353 |
||
|
DH10B: 370568..369684 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
tsx(del) (Keio:JW0401) |
deletion |
deletion |
|||||
|
tsxN276Y |
N276Y |
(in phage resistant mutant) |
Strain variation; seeded from UniProt:P0A927 | ||||
|
tsx-247::Tn10 |
Insertion at 430,667 bp in MG1655 (NC_000913) |
adapted from Nichols et al.[4] |
Synonyms: | ||||
|
tsx-33 |
|||||||
|
tsx-29 |
|||||||
|
tsx-67 |
|||||||
|
tsx-1 |
|||||||
|
tsx-70 |
|||||||
|
tsx-358 |
|||||||
|
tsx-81 |
|||||||
|
tsx-76 |
|||||||
|
tsx-79 |
|||||||
|
tsx-84 |
|||||||
|
tsx-95 |
|||||||
|
tsx-7 |
|||||||
|
tsx-63 |
|||||||
|
tsx-78 |
|||||||
|
tsx-96 |
|||||||
|
tsx-71 |
|||||||
|
tsx-64 |
|||||||
|
tsx-273 |
|||||||
|
tsx-97 |
|||||||
|
tsx-0 |
|||||||
|
tsx-68 |
|||||||
|
tsx-463 |
|||||||
|
tsx-352 |
|||||||
|
tsx-83 |
|||||||
|
tsx-80 |
|||||||
|
tsx-82 |
|||||||
|
tsx-65 |
|||||||
|
tsx-354 |
|||||||
|
tsx-356 |
|||||||
|
tsx-357 |
|||||||
|
tsx-3 |
|||||||
|
tsx-61 |
|||||||
|
tsx-59 |
|||||||
|
tsx-6 |
|||||||
|
tsx-274 |
|||||||
|
tsx-87 |
|||||||
|
tsx-23 |
|||||||
|
tsx-25 |
|||||||
|
tsx-464 |
|||||||
|
tsx-36 |
|||||||
|
tsx-57 |
|||||||
|
tsx-5 |
|||||||
|
tsx-353 |
|||||||
|
tsx-462::Tn10 |
|||||||
|
tsx-93 |
|||||||
|
tsx-466 |
|||||||
|
tsx-69 |
|||||||
|
tsx-465(Am) |
amber (UAG) mutation | ||||||
|
tsx-72 |
|||||||
|
tsx-21 |
|||||||
|
tsx-2 |
|||||||
|
tsx-85 |
|||||||
|
tsx-460 |
|||||||
|
tsx-18 |
|||||||
|
tsx-17 |
|||||||
|
tsx-27 |
|||||||
|
tsx-4 |
|||||||
|
tsx-58 |
|||||||
|
tsx-62 |
|||||||
|
tsx-73 |
|||||||
|
tsx-459 |
|||||||
|
tsx-19 |
|||||||
|
tsx-37 |
|||||||
|
tsx-77 |
|||||||
|
tsx-247::Tn10 |
|||||||
|
tsx-3100::Tn10kan |
|||||||
|
tsx-35 |
|||||||
|
tsx-74 |
|||||||
|
tsx-75 |
|||||||
|
tsx-773(del)::kan |
|||||||
|
tsx mutation in P1807 |
Sensitivity to |
Reduced sensitivity toward albicidin. |
See Figure 1 B for full experimental results. | ||||
|
tsx mutation in strain P1807 |
Metabolic uptake |
Mutation to the tsx region caused a reduced uptake of nucleoside. |
See figure 2 for full experimental results. | ||||
|
tsx mutation in strain GP4 |
Metabolic uptake |
Mutation to the tsx region caused a reduced uptake of ablicidin. |
These results support the theory that ablicidin resistance is due to reduced uptake of the antibiotic. See figure 3b for experimental results. | ||||
|
tsx- in P407 |
Resistant to |
Resistance to Bacteriophage T6 |
Mutation to the tsx gene confers resistance to phage T6, possibly by reducing the production of a protein thought to be involved in phage binding, tsx-protein. | ||||
|
tsx--con- in P1731 |
Resistant to |
Resistance to Bacteriophage T6 |
A double mutation to the tsx and con gene confers resistance to phage T6, possibly by reducing the production of a protein thought to be involved in phage binding, tsx-protein. | ||||
|
tsx- in P407 |
Resistant to |
Resistance to Colicin K |
Mutation to the tsx gene confers resistance to Colicin K possibly by reducing the production of a specific protein, tsx-protein. | ||||
|
tsx--con- in P1731 |
Resistant to |
Resistance to Colicin K |
A double mutation to the tsx and con gene confers resistance to Colicin K, possibly by reducing the production of a protein thought to be involved in phage binding, tsx-protein. | ||||
|
tsx-2 in strain KG16 |
Resistant to |
Resistance to strain Phage T6 |
tsx-2 class of mutants were resistant to bacteriophage T6. This was also seen in strain KG19. | ||||
|
tsx-2 in strain KG16 |
Resistant to |
Resistance to Colicin K |
tsx-2 class of mutants became more resistant to Colicin K. This was also seen in strain KG19. | ||||
|
tsx-1 in strain GG24 |
Resistant to |
Resistance to strain Phage T6 |
tsx-1 class of mutants developed an increased resistance toward bacteriophage T6. This was also seen in strain GG26. | ||||
|
tsx-1 in strain GG24d |
Resistant to |
Resistance to Colicin K |
tsx-2 class of mutants became more resistant to Colicin K. This was also seen in strain GG24. | ||||
|
tsx-2 in strain KG16 |
Growth Phenotype |
Muciod growth |
It was found that the tsx-2 class of mutants produced a Muciod type growth configuration. This included strain KG19. | ||||
|
tsx-2 in strain KG16 |
Sensitivity to |
Increased sensitivity to Neomycin. |
It was found that the tsx-2 class of mutants became increasingly sensitive to aminoglycosides Neomycin and Kanamycin. This included strain KG19. | ||||
|
tsx-2 in strain KG16 |
Sensitivity to |
Increased sensitivity to Kanamycin. |
It was found that the tsx-2 class of mutants became increasingly sensitive to aminoglycosides Neomycin and Kanamycin. This included strain KG19. | ||||
|
tsx-2 |
Sensitivity to |
The tsx-2 mutation caused increased sensitivity toward the antibiotic nalidixic acid. |
Experimental Strain: KG16 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0401 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAAAAACATTACTGGCAGC Primer 2:CCGAAGTTGTAACCTACTACCAG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 23% [4] | ||
|
Linked marker |
est. P1 cotransduction: 33% [4] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 3.3 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 4.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 5.0 5.1 5.2 Birch, RG et al. (1990) Stable albicidin resistance in Escherichia coli involves an altered outer-membrane nucleoside uptake system. J. Gen. Microbiol. 136 51-8 PubMed
- ↑ 6.0 6.1 6.2 6.3 Eeg-Larsen, N & Myhre, L (1976) Early signs of calcium and phosphorus deficiency. Bibl Nutr Dieta 129-36 PubMed
- ↑ 7.0 7.1 7.2 7.3 7.4 7.5 7.6 7.7 Brunner, DP et al. (1982) Exchange of colicin receptor capacity between strains of Escherichia coli sensitive or resistant to colicin K-K235. Arch. Microbiol. 131 229-34 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
