cyaA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
cyaA |
|---|---|
| Mnemonic |
Cyclase, adenylate |
| Synonyms |
ECK3800, b3806, JW3778, cya[1], cya |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
85.98 minutes |
MG1655: 3989176..3991722 |
||
|
NC_012967: 3952983..3955529 |
||||
|
NC_012759: 3878845..3881391 |
||||
|
W3110 |
|
W3110: 3645528..3642982 |
||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
cyaA (Keio:JW3778) |
deletion |
deletion |
|||||
|
cyaA::Tn5KAN-I-SceI (FB21464) |
Insertion at nt 1522 in Minus orientation |
does not contain pKD46 | |||||
|
cyaA::Tn5KAN-I-SceI (FB21465) |
Insertion at nt 1522 in Minus orientation |
contains pKD46 | |||||
|
cyaA2(del) |
|||||||
|
cyaA854(del) |
|||||||
|
cyaA1 |
|||||||
|
cyaA1400(del)::kan |
|||||||
|
cyaA201(del) |
|||||||
|
cyaA1404(del)::FRT |
|||||||
|
cyaA1403(del)::kan |
|||||||
|
cyaA161 |
|||||||
|
cyaA751(del)::kan |
|||||||
|
cya(del) |
deletion |
deletion |
Auxotrophies |
Mutation inhibits stationary phase SOS induction of the yebG gene (i.e. dependent on intracellular cAMP levels), fig 3. |
|||
|
cya in strain L176 |
Sensitivity to |
sensitivity to streptozotocin |
strain L176 |
figure 3 | |||
|
cya (del) crp (del) |
Sensitivity to |
sensitivity to streptozotocin |
Strain: CA8445 |
table 2 and figure 3 | |||
|
cya crp* relA + |
Resistant to |
crp allele that modified cyclic AMP receptor proteins, which acts independently of cyclic AMP, is resistant to smg (serine+methionine+glycine) in a relA background. |
Experimental strain: BM6163 |
table 4 | |||
|
cya(del) |
Resistant to |
Resistance to UV irridiation (254nm). |
Strain: GE1068 |
See figure 1 | |||
|
Salmonella typhimurium LT2 cya-deficient |
Resistant to |
partially resistant to 22 antibiotics (including fosfomycin, nalidixic acid, and streptomycin) |
|||||
|
cya in strain NCR-C57 |
Resistant to |
Resistance to T6 Phage |
Experiential Strain: NCR-C57 Parental Strain: NCR-701 |
Table 3 | |||
|
cyaA751(del)::FRTKanFRT |
deletion |
Mutagenesis Rate |
Decrease in Stress Induced Mutagenesis (SIM). |
Parent Strain: 23224554 Experimental Strain: SMR11998 |
The mutation conferred a significant decrease in SIM with a reduction in mutant frequency by 67 to 89 percent. See table S3 for full experimental data. | ||
|
cya-408 |
Resistant to |
Resistant to Fosfomycin |
Strain: TA3301 |
Strain Parent: LT2 Strain donor: TA2301 | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3778 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTACCTCTATATTGAGACTCT Primer 2:CCaGAAAAATATTGCTGTAATAG | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 23% [20] | ||
|
metE3079::Tn10 |
Linked marker |
est. P1 cotransduction: 49% [20] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 5.0 5.1 Brickman, E et al. (1973) Genetic characterization of mutations which affect catabolite-sensitive operons in Escherichia coli, including deletions of the gene for adenyl cyclase. J. Bacteriol. 116 582-7 PubMed
- ↑ 6.0 6.1 6.2 Shah, S & Peterkofsky, A (1991) Characterization and generation of Escherichia coli adenylate cyclase deletion mutants. J. Bacteriol. 173 3238-42 PubMed
- ↑ Glaser, P et al. (1989) Molecular characterization of two cya mutations, cya-854 and cyaR1. J. Bacteriol. 171 5176-8 PubMed
- ↑ Kumar, S (1976) Properties of adenyl cyclase and cyclic adenosine 3',5'-monophosphate receptor protein-deficient mutants of Escherichia coli. J. Bacteriol. 125 545-55 PubMed
- ↑ 9.0 9.1 Datsenko, KA & Wanner, BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97 6640-5 PubMed
- ↑ Haldimann, A et al. (1998) Use of new methods for construction of tightly regulated arabinose and rhamnose promoter fusions in studies of the Escherichia coli phosphate regulon. J. Bacteriol. 180 1277-86 PubMed
- ↑ Oh, TJ & Kim, IG (1999) Identification of genetic factors altering the SOS induction of DNA damage-inducible yebG gene in Escherichia coli. FEMS Microbiol. Lett. 177 271-7 PubMed
- ↑ 12.0 12.1 Lengeler, J (1980) Characterisation of mutants of Escherichia coli K12, selected by resistance to streptozotocin. Mol. Gen. Genet. 179 49-54 PubMed
- ↑ Daniel, J & Danchin, A (1979) Involvement of cyclic AMP and its receptor protein in the sensitivity of Escherichia coli K 12 toward serine: excretion of 2-ketobutyrate, a precursor of isoleucine. Mol. Gen. Genet. 176 343-50 PubMed
- ↑ Puyo, MF et al. (1992) UV resistance of E. coli K-12 deficient in cAMP/CRP regulation. Mutat. Res. 282 247-52 PubMed
- ↑ 15.0 15.1 Alper, MD & Ames, BN (1978) Transport of antibiotics and metabolite analogs by systems under cyclic AMP control: positive selection of Salmonella typhimurium cya and crp mutants. J. Bacteriol. 133 149-57 PubMed
- ↑ Alderman, EM et al. (1979) Cyclic adenosine 3',5'-monophosphate regulation of the bacteriophage T6/colicin K receptor in Escherichia coli. J. Bacteriol. 140 369-76 PubMed
- ↑ Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 20.0 20.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
