crl:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
crl |
|---|---|
| Gene Synonym(s) |
ECK0241, b0240, JW0230[1], JW0230 |
| Product Desc. |
Crl transcriptional regulator[2][3] Stimulates RNA polymerase holoenzyme formation; stimulates RpoS activity during stationary phase; mutants display rpoS mutant phenocopy; does not reduce amount of RpoS protein[4] |
| Product Synonyms(s) |
DNA-binding transcriptional regulator[1], B0240[2][1], Crl[2][1] , ECK0241, JW0230, b0240 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
RpoD, RpoS and RpoH sigma factor-containing holoenzyme assembly is stimulated by Crl (Gaal, 2006). Accumulation of Crl during stationary phase at 30C, but not 37C, suggests it is a thermosensor controlling sigma(S) activity. Initially identified due to reduction of RpoS-dependent curlin (csgAB) expression.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
crl |
|---|---|
| Mnemonic |
Curli |
| Synonyms |
ECK0241, b0240, JW0230[1], JW0230 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
5.56 minutes |
MG1655: 257829..258230 |
||
|
NC_012967: 262320..262721 |
||||
|
NC_012759: 257828..258229 |
||||
|
W3110 |
|
W3110: 257829..258230 |
||
|
DH10B: 231933..232334 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
257832 |
Edman degradation |
PMID:2649795 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
crl(del) (Keio:JW0230) |
deletion |
deletion |
PMID:16738554 |
||||
|
crl-758(del)::kan |
PMID:16738554 |
||||||
|
G insertion at genome position 257899 |
PMID:22081388 |
polymorphic in different MG1655 isolates | |||||
|
IS1 insertion at genome position 257899 |
PMID:22081388 |
polymorphic in different MG1655 isolates | |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0230 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCACGTTACCGAGTGGACACCC Primer 2:CCCGCCGTTAACTTCACCGGCTC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 38% [6] | ||
|
Linked marker |
est. P1 cotransduction: 94% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11092 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11092 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001080 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1084 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000821 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
Crl |
|---|---|
| Synonyms |
DNA-binding transcriptional regulator[1], B0240[2][1], Crl[2][1] , ECK0241, JW0230, b0240 |
| Product description |
Crl transcriptional regulator[2][3] Stimulates RNA polymerase holoenzyme formation; stimulates RpoS activity during stationary phase; mutants display rpoS mutant phenocopy; does not reduce amount of RpoS protein[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0005737 |
cytoplasm |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01178 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016987 |
sigma factor activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01178 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0045941 |
positive regulation of transcription |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01178 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
tatE |
PMID:16606699 |
Experiment(s):EBI-1136001 | |
|
Protein |
| |||
| edit table |
</protect>
Notes
Crl enhances RpoS activity in vivo.[8] Crl has been shown to interact directly with RpoS in vivo and in vitro[7]. In vitro results sugges that it acts to stimulate RpoS activity by enhancing formation of RNA polymerase sigma 38.[9] In vitro it has been shown to stimulate formation of RNA polymerase sigma70 and RNA polymerase sigma32.[9]
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
cytoplasm |
From EcoCyc[3] |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MTLPSGHPKS RLIKKFTALG PYIREGKCKD NRFFFDCLAV CVNVKPAPEV REFWGWWMEL EAQESRFTYS YQFGLFDKAG DWKSVPVKDT EVVERLEHTL REFHEKLREL LTTLNLKLEP ADDFRDEPVK LTA |
| Length |
133 |
| Mol. Wt |
15.654 kDa |
| pI |
6.7 (calculated) |
| Extinction coefficient |
26,470 - 26,845 (calc based on 3 Y, 4 W, and 3 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Met1 is cleaved to generate mature protein [10].
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0000821 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG11092 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11092 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001080 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1084 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
3.48E+02 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
8827 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
5379 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
6819 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:257809..257849
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for crl | |
|
microarray |
Summary of data for crl from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (257690..257844) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to crl Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11092 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1084 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11092 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001080 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000821 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
CRL |
From SHIGELLACYC |
|
E. coli O157 |
CRL |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11092 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11092 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001080 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1084 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000821 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 7.0 7.1 Bougdour, A et al. (2004) Crl, a low temperature-induced protein in Escherichia coli that binds directly to the stationary phase sigma subunit of RNA polymerase. J. Biol. Chem. 279 19540-50 PubMed
- ↑ Pratt, LA & Silhavy, TJ (1998) Crl stimulates RpoS activity during stationary phase. Mol. Microbiol. 29 1225-36 PubMed
- ↑ 9.0 9.1 Gaal, T et al. (2006) Crl facilitates RNA polymerase holoenzyme formation. J. Bacteriol. 188 7966-70 PubMed
- ↑ Arnqvist, A et al. (1992) The Crl protein activates cryptic genes for curli formation and fibronectin binding in Escherichia coli HB101. Mol. Microbiol. 6 2443-52 PubMed
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories


