argR:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
argR |
|---|---|
| Mnemonic |
Arginine |
| Synonyms |
ECK3226, b3237, JW3206, xerA, Rarg[1], Rarg |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
72.91 minutes |
MG1655: 3382725..3383195 |
||
|
NC_012967: 3312600..3313070 |
||||
|
NC_012759: 3269873..3270343 |
||||
|
W3110 |
|
W3110: 3384558..3385028 |
||
|
DH10B: 3480470..3480940 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3382725 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
argRG123D |
G123D |
Auxotrophies |
Defective binding to arginine and to ARG box. Forms dimers not hexamers |
seeded from UniProt:P0A6D0 | |||
|
argRS44F |
S44F |
Auxotrophies |
Defective binding to ARG box |
seeded from UniProt:P0A6D0 | |||
|
argRS47L |
S47L |
Auxotrophies |
Defective binding to ARG box |
seeded from UniProt:P0A6D0 | |||
|
argRP76L |
P76L |
Auxotrophies |
Increased affinity for ARG box in the absence of arginine |
seeded from UniProt:P0A6D0 | |||
|
argRA105V |
A105V |
Auxotrophies |
Defective binding to arginine and to ARG box |
seeded from UniProt:P0A6D0 | |||
|
argRE21K |
E21K |
Auxotrophies |
Increased affinity for ARG box in the presence of arginine |
seeded from UniProt:P0A6D0 | |||
|
ΔargR (Keio:JW3206) |
deletion |
deletion |
Auxotrophies |
||||
|
argR::Tn5KAN-I-SceI (FB21082) |
Insertion at nt 118 in Minus orientation |
Auxotrophies |
contains pKD46 | ||||
|
ΔargR::kan |
deletion |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
|||
|
argR38 |
Auxotrophies |
||||||
|
argR40 |
Auxotrophies |
||||||
|
argR63 |
Auxotrophies |
||||||
|
argR64 |
Auxotrophies |
||||||
|
argR84 |
Auxotrophies |
||||||
|
[argR141] |
Auxotrophies |
null allele | |||||
|
argR142 |
Auxotrophies |
||||||
|
ΔargR762::kan |
deletion |
deletion |
Auxotrophies |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3206 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCGAAGCTCGGCTAAGCAAGA Primer 2:CCAAGCTCCTGGTCGAACAGCTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 50% [9] | ||
|
Linked marker |
est. P1 cotransduction: 28% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Lim, DB et al. (1987) Nucleotide sequence of the argR gene of Escherichia coli K-12 and isolation of its product, the arginine repressor. Proc. Natl. Acad. Sci. U.S.A. 84 6697-701 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
