{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	ahpC
Gene Synonym(s)	ECK0599, b0605, JW0598, ssi8^[1]^[2], tpx
Product Desc.	AhpC component^[2]^[3]; Component of alkylhydroperoxide reductase^[3] Alkyl hydroperoxide reductase, subunit C; reduced by the AhpF subunit^[4]
Product Synonyms(s)	alkyl hydroperoxide reductase, C22 subunit^[1], B0605^[2]^[1], AhpC^[2]^[1], Ssi8^[2]^[1] , ECK0599, JW0598, tpx, b0605
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): ahpCF^[2], OP00101, ahpC
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

AhpCF protects aerobic, phosphate-starved cells from oxidative damage. Binds TrxA (Kumar, 2004).^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	ahpC
Mnemonic	Alkyl hydroperoxide
Synonyms	ECK0599, b0605, JW0598, ssi8^[1]^[2], tpx
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	13.75 minutes	MG1655: 638168..638731 <gbrowseImage> name=NC_000913:638168..638731 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 620996..621559 <gbrowseImage> name=NC_012967:620996..621559 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 540928..541491 <gbrowseImage> name=NC_012759:540928..541491 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 638168..638731 <gbrowseImage> name=NC_007779:638168..638731 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 577500..578063 <gbrowseImage> name=NC_010473:577500..578063 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
DH10B		DH10B: 690760..691323 <gbrowseImage> name=NC_010473:690760..691323 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	638171	Edman degradation	PMID:1575737 PMID:7499381 PMID:8774726 PMID:9298646 PMID:9600841 PMID:10094700 PMID:10648109
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Reference	Availability
ΔahpC (Keio:JW0598)	deletion	deletion	PMID:16738554	Shigen CGSC8713^[5]
ahpC*	triplet repeat expansion		PMID: 18206967
ΔahpC744::kan			PMID:16738554	CGSC:99954
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0598	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCTCCTTGATTAACACCAAAAT Primer 2:CCGATTTTACCAACCAGGTCCAG
4A5	Kohara Phage	Genobase	PMID:3038334
3G5	Kohara Phage	Genobase	PMID:3038334
dsbG601::Tn10	Linked marker	CAG12149 = CGSC7346^[5]	est. P1 cotransduction: 92% ^[6] Synonyms:zbd-601::Tn10, zbe-601::Tn10
crcA280::Tn10	Linked marker	CAG12077 = CGSC7347^[5]	est. P1 cotransduction: 57% ^[6] Synonyms:zbe-280::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11384	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11384	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001351	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945225	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1357	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0002090	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	AhpC
Synonyms	alkyl hydroperoxide reductase, C22 subunit^[1], B0605^[2]^[1], AhpC^[2]^[1], Ssi8^[2]^[1] , ECK0599, JW0598, tpx, b0605
Product description	AhpC component^[2]^[3]; Component of alkylhydroperoxide reductase^[3] Alkyl hydroperoxide reductase, subunit C; reduced by the AhpF subunit^[4]
EC number (for enzymes)	1.6.4.-^[1]
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005737	cytoplasm				C	Seeded from Riley et al 2006 ^[1].	Missing: evidence, reference
	GO:0005829	cytosol	PMID:16858726	IDA: Inferred from Direct Assay		C	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	PMID:16858726	IDA: Inferred from Direct Assay		C	Seeded from EcoCyc (v14.0)	complete
	GO:0045454	cell redox homeostasis	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR017936	P	Seeded from EcoCyc (v14.0)	complete
	GO:0051920	peroxiredoxin activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR017559	F	Seeded from EcoCyc (v14.0)	complete
	GO:0051920	peroxiredoxin activity	GOA:spec GO_REF:0000003	IEA: Inferred from Electronic Annotation	EC:1.11.1.15	F	Seeded from EcoCyc (v14.0)	complete
	GO:0055114	oxidation reduction	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR017559	P	Seeded from EcoCyc (v14.0)	complete
	GO:0004601	peroxidase activity	PMID:11717276	IGI: Inferred from Genetic Interaction	EcoliWiki:katG	F		complete
	GO:0055114	oxidation reduction	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0560	P	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	PMID:7499381	IDA: Inferred from Direct Assay		C		complete
	GO:0009970	cellular response to sulfate starvation	PMID:8774726	IDA: Inferred from Direct Assay		P		complete
	GO:0032843	hydroperoxide reductase activity	PMID:7644465	IDA: Inferred from Direct Assay		F		complete
	GO:0016684	oxidoreductase activity, acting on peroxide as acceptor	PMID:7644465	IMP: Inferred from Mutant Phenotype		F		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of alkylhydroperoxide reductase	could be indirect
Protein	rhsC		PMID:16606699	Experiment(s):EBI-1137372
Protein	lacZ		PMID:16606699	Experiment(s):EBI-1137372
Protein	rhsE		PMID:16606699	Experiment(s):EBI-1137372
Protein	rtcB		PMID:16606699	Experiment(s):EBI-1137372
Protein	recB		PMID:16606699	Experiment(s):EBI-1137372
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
cytoplasm
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MSLINTKIKP FKNQAFKNGE FIEITEKDTE GRWSVFFFYP ADFTFVCPTE LGDVADHYEE LQKLGVDVYA VSTDTHFTHK AWHSSSETIA KIKYAMIGDP TGALTRNFDN MREDEGLADR ATFVVDPQGI IQAIEVTAEG IGRDASDLLR KIKAAQYVAS HPGEVCPAKW KEGEATLAPS LDLVGKI
Length	187
Mol. Wt	20.761 kDa
pI	5.0 (calculated)
Extinction coefficient	23,950 - 24,200 (calc based on 5 Y, 3 W, and 2 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P0AE08
Modification Site	84	phosphorylation site at S84	probability greater than 75%	PMID:17938405
Modification Site	146	phosphorylation site at S146	probability greater than 75%	PMID:17938405
Domain	4..134	PF00578 AhpC/TSA family		PMID:19920124
Domain	154..186	PF10417 C-terminal domain of 1-Cys peroxiredoxin		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=ahpC taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16128588	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945225	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0002090	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0AE08	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11384	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11384	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945225	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001351	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1357	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	1.97E+05	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	E. coli K-12 EMG2	300	molecules/cell	Medium: MOPS glucose minimal Temperature (°C): 37 Doubling time (min): Growth phase: Exponential OD: OD600 = 0.2 to 0.25 other: aerated	Quantitative protein sequencing	Spot ID: M97-2	PMID: 9298646
Protein	E. coli K-12 EMG2	2250	molecules/cell	Medium: MOPS glucose minimal Temperature (°C): 37 Doubling time (min): Growth phase: Exponential OD: OD600 = 0.2 to 0.25 other: aerated	Quantitative protein sequencing	Spot ID: M2-J	PMID: 9298646
Protein	E. coli K-12 EMG2	6040	molecules/cell	Medium: MOPS glucose minimal Temperature (°C): 37 Doubling time (min): Growth phase: Exponential OD: OD600 = 0.2 to 0.25 other: aerated	Quantitative protein sequencing	Spot ID: M3J.l	PMID: 9298646
Protein	E. coli K-12 MG1655	92449	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	37153	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	76357	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
ahpCF
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:638148..638188 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0605 (EcoliWiki Page)	NCBI GEO profiles for ahpC
microarray	GenExpDB:b0605 (EcoliWiki Page)	Summary of data for ahpC from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (637759..638206) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ13; Well:D11^[7]
edit table

Notes

Accessions Related to ahpC Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11384	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1357	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0605
EcoGene	EcoGene:EG11384	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001351	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0002090	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000026815 (score: 1.000; bootstrap: 98%) ENSANGP00000010951 (score: 1.000; bootstrap: 99%) ENSANGP00000019782 (score: 0.502)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000033015 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Arabidopsis thaliana	AT5G06290 (score: 1.000; bootstrap: 99%) AT3G11630 (score: 0.777)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000011505 (score: 1.000; bootstrap: 99%) ENSBTAP00000015996 (score: 0.366) ENSBTAP00000008107 (score: 0.348) ENSBTAP00000004751 (score: 0.242)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00025442 (score: 1.000; bootstrap: 99%) WBGene00037564 (score: 0.114)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00006434 (score: 1.000; bootstrap: 99%) WBGene00011110 (score: 0.447)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000025278 (score: 1.000; bootstrap: 99%) ENSCAFP00000006827 (score: 0.668) ENSCAFP00000003384 (score: 0.592) ENSCAFP00000019709 (score: 0.513) ENSCAFP00000017833 (score: 0.453) ENSCAFP00000007440 (score: 0.415) ENSCAFP00000008263 (score: 0.351)	From Inparanoid:20070104
Ciona intestinalis	ENSCINP00000007255 (score: 1.000; bootstrap: 99%) ENSCINP00000013246 (score: 0.367) ENSCINP00000006141 (score: 0.338)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-040718-170 (score: 1.000; bootstrap: 99%) ZDB-CDNA-040718-193 (score: 1.000; bootstrap: 99%) ZDB-CDNA-050320-35 (score: 0.729) ZDB-GENE-050320-35 (score: 0.729) ZDB-CDNA-050320-21 (score: 0.469) ZDB-CDNA-050417-74 (score: 0.465) ZDB-GENE-030826-18 (score: 0.465)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0231647 (score: 1.000; bootstrap: 99%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0038519 (score: 1.000; bootstrap: 96%) FBgn0040308 (score: 0.350) FBgn0040309 (score: 0.297) FBgn0036490 (score: 0.209)	From Inparanoid:20070104
Drosophila pseudoobscura	GA19159-PA (score: 1.000; bootstrap: 99%) GA11781-PA (score: 0.305) GA14060-PA (score: 0.284)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000015246 (score: 1.000; bootstrap: 100%) ENSGALP00000026337 (score: 0.351) ENSGALP00000016629 (score: 0.332)	From Inparanoid:20070104
Homo sapiens	ENSP00000298510 (score: 1.000; bootstrap: 99%) ENSP00000319964 (score: 0.357) ENSP00000301522 (score: 0.336) ENSP00000262746 (score: 0.328) ENSP00000338995 (score: 0.056)	From Inparanoid:20070104
Macaca mulatta	ENSMMUP00000010873 (score: 1.000; bootstrap: 99%) ENSMMUP00000028144 (score: 0.354) ENSMMUP00000007512 (score: 0.244) ENSMMUP00000008176 (score: 0.239)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000008649 (score: 1.000; bootstrap: 99%) ENSMODP00000002901 (score: 0.637) ENSMODP00000009688 (score: 0.548) ENSMODP00000011601 (score: 0.489)	From Inparanoid:20070104
Mus musculus	MGI:109486 (score: 1.000; bootstrap: 99%) MGI:99523 (score: 0.668) MGI:3645884 (score: 0.629) MGI:1859815 (score: 0.529) MGI:88034 (score: 0.467)	From Inparanoid:20070104
Oryza gramene	O81480 (score: 1.000; bootstrap: 99%) Q96468 (score: 0.723) P80602 (score: 0.720) Q6ER94 (score: 0.696) Q7X679 (score: 0.258)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000001167 (score: 1.000; bootstrap: 99%) ENSPTRP00000037272 (score: 0.335) ENSPTRP00000017998 (score: 0.248) ENSPTRP00000004125 (score: 0.198)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000004799 (score: 1.000; bootstrap: 99%) ENSRNOP00000023132 (score: 0.688) ENSRNOP00000023972 (score: 0.677) ENSRNOP00000043982 (score: 0.502) ENSRNOP00000015186 (score: 0.460) ENSRNOP00000029235 (score: 0.266)	From Inparanoid:20070104
Saccharomyces cerevisiae	YDR453C (score: 1.000; bootstrap: 90%) YML028W (score: 0.865)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPCC5763c (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000135519 (score: 1.000; bootstrap: 99%) NEWSINFRUP00000151126 (score: 0.714) NEWSINFRUP00000159443 (score: 0.530) NEWSINFRUP00000139714 (score: 0.440)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00013358001 (score: 1.000; bootstrap: 99%) GSTENP00022646001 (score: 0.717) GSTENP00019030001 (score: 0.517) GSTENP00037525001 (score: 0.212)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000024196 (score: 1.000; bootstrap: 99%)	From Inparanoid:20070104
Shigella flexneri	AHPC	From SHIGELLACYC
E. coli O157	AHPC	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00578 AhpC/TSA family
Panther (EcoliWiki Page)	PTHR10681:SF7
Superfamily (EcoliWiki Page)	SUPERFAMILY:52833
Pfam (EcoliWiki Page)	PF10417 C-terminal domain of 1-Cys peroxiredoxin
EcoCyc	EcoCyc:EG11384	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11384	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001351	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1357	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0002090	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

ahpC:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to ahpC Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search