parC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
parC | |
|---|---|---|
| Mnemonic |
partitioning of the nucleoid | |
| Synonyms |
ECK3010, b3019, JW2987[1] | |
| edit table | ||
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
The partitioning defect comes from the inability of these cells to partition the nucleoids into daughter cells. This leads to filamented cells with a cluster of DNA and other DNA- free cells
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
68.15 minutes |
MG1655: 3163995..3161737 |
||
|
W3110 |
|
W3110: 3164629..3162371 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔparC (Keio:JW2987) |
deletion |
deletion |
|||||
|
parC1215 |
Growth Phenotype |
ts @ 42 |
|||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2987 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCGATATGGCAGAGCGCCT Primer 2:CCtTCTTCGCTATCACCGCTGCT | |
|
Linked marker |
est. P1 cotransduction: 67% [6] | ||
|
Linked marker |
est. P1 cotransduction: 56% [6] | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kato, J et al. (1990) New topoisomerase essential for chromosome segregation in E. coli. Cell 63 393-404 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).