priA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
priA |
|---|---|
| Mnemonic |
Primosome |
| Synonyms |
ECK3927, b3935, JW3906, srgA[1], srgA |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
88.86 minutes |
MG1655: 4124833..4122635 |
||
|
NC_012967: 4106293..4104095 |
||||
|
NC_012759: 4012304..4014502 |
||||
|
W3110 |
|
W3110: 3509871..3512069 |
||
|
DH10B: 4224530..4222332 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4122635 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔpriA (Keio:JW3906) |
deletion |
deletion |
|||||
|
priA1::KanR |
|
||||||
|
ΔpriA722::kan |
|||||||
|
priA2::kan |
inserted kan gene fragment |
|
|||||
|
priA2::kan ftsKC |
Growth Phenotype |
synthetically lethal |
|||||
|
priA in MDS42 |
deletion |
Sensitivity to |
increases sensitivity to Bicyclomycin |
fig. 2
| |||
| edit table |
Notes
spa-47 (dnaC) suppresses the recombination and DSB repair defects seen in the priA1::kan mutant [8]
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3906 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCCCGTTGCCCACGTTGCCTT Primer 2:CCACCCTCAATCGGATCAACATC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 5% [13] | ||
|
Linked marker |
est. P1 cotransduction: 47% [13] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Nurse, P et al. (1990) Molecular cloning and DNA sequence analysis of Escherichia coli priA, the gene encoding the primosomal protein replication factor Y. Proc. Natl. Acad. Sci. U.S.A. 87 4615-9 PubMed
- ↑ Lee, EH et al. (1990) The priA gene encoding the primosomal replicative n' protein of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 87 4620-4 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Nurse, P et al. (1991) Inactivation of the Escherichia coli priA DNA replication protein induces the SOS response. J. Bacteriol. 173 6686-93 PubMed
- ↑ Xu, L & Marians, KJ (2000) Purification and characterization of DnaC810, a primosomal protein capable of bypassing PriA function. J. Biol. Chem. 275 8196-205 PubMed
- ↑ 8.0 8.1 8.2 Kogoma, T et al. (1996) The DNA replication priming protein, PriA, is required for homologous recombination and double-strand break repair. J. Bacteriol. 178 1258-64 PubMed
- ↑ McCool, JD & Sandler, SJ (2001) Effects of mutations involving cell division, recombination, and chromosome dimer resolution on a priA2::kan mutant. Proc. Natl. Acad. Sci. U.S.A. 98 8203-10 PubMed
- ↑ Washburn, RS & Gottesman, ME (2011) Transcription termination maintains chromosome integrity. Proc. Natl. Acad. Sci. U.S.A. 108 792-7 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 12.0 12.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 13.0 13.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).