parC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
parC |
|---|---|
| Mnemonic |
partitioning of the nucleoid Partition |
| Synonyms |
ECK3010, b3019, JW2987[1] |
| edit table |
Notes
The partitioning defect comes from the inability of these cells to partition the nucleoids into daughter cells. This results in filamentous cells with a cluster of nucleoid at the center and subsequent DNA-free cells.
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
68.15 minutes |
MG1655: 3163995..3161737 |
||
|
NC_012967: 3100145..3097887 |
||||
|
W3110 |
|
W3110: 3164629..3162371 |
||
|
DH10B: 3261740..3259482 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
parC1215 |
G2199A |
G703D |
Growth Phenotype |
ts @ 42 |
actual nucleotide mapping was referenced in [2] | ||
|
parC10 |
Y120H |
DNA nicking independent of ATP hydrolysis |
| ||||
| edit table |
Notes
The Keio collection[5] lists a deletion of parC, which is an essential gene. The insertion in this strain is a duplication of the parC region.[6]
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2987 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCGATATGGCAGAGCGCCT Primer 2:CCtTCTTCGCTATCACCGCTGCT | |
|
Linked marker |
est. P1 cotransduction: 67% [9] | ||
|
Linked marker |
est. P1 cotransduction: 56% [9] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Kato, J et al. (1990) New topoisomerase essential for chromosome segregation in E. coli. Cell 63 393-404 PubMed
- ↑ Kato, J et al. (1988) Gene organization in the region containing a new gene involved in chromosome partition in Escherichia coli. J. Bacteriol. 170 3967-77 PubMed
- ↑ Yokochi, T et al. (1996) DNA nicking by Escherichia coli topoisomerase IV with a substitution mutation from tyrosine to histidine at the active site. Genes Cells 1 1069-75 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).