lexA:Gene: Difference between revisions

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	91.71 minutes	MG1655: 4255138..4255746 <gbrowseImage> name=NC_000913:4255138..4255746 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 4236047..4236655 <gbrowseImage> name=NC_012967:4236047..4236655 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 4193983..4194591 <gbrowseImage> name=NC_012759:4193983..4194591 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 4260705..4261313 <gbrowseImage> name=NC_007779:4260705..4261313 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4354834..4355442 <gbrowseImage> name=NC_010473:4354834..4355442 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

A description of the lexA gene may be found in Markham et al. (1981)^[2].

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
lexAG85D		G85D		(in lexA3, resistant to cleavage)			Strain variation; seeded from UniProt:P0A7C2
lexA107						CGSC:6267
lexA1(Ind-)				non-inducible SOS response		CGSC:9237
lexA41(ts)				temperature sensitive		CGSC:9601
lexA3(Ind-)				non-inducible SOS response		CGSC:9602
lexA51						CGSC:10280
lexA101						CGSC:11964
lexA102						CGSC:11979
lexA109						CGSC:11985
lexA103						CGSC:14425
lexA104						CGSC:14427
lexA105						CGSC:14429
lexA106						CGSC:14431
lexA108						CGSC:14439
lexA71::Tn5						CGSC:30813
lexA2	C461T	T154I	Sensitivity to	hypocleavable repressor leads to a sensitivity to DNA damage	PMID:3127383^[3]
spr					PMID:2834329^[4] PMID:7038393^[5]		uninducible, not cleaved during SOS response
lexA264 (Silent SalI site )	GGT->GTT	G80V		Ind- phenotype	PMID:2834329^[4]		Formic acid was used as the mutagen
lexA261 (Silent SalI site )	GGT->GAT	G80D		Ind- phenotype	PMID:2834329^[4]		Hydroxylamine was used as the mutagen
lexA266 (Silent SalI site )	GTG->GAG	V82E		Ind- phenotype	PMID:2834329^[4]		Formic acid was used as the mutagen
lexA265 (Silent SalI site )	GTG->ATG	V82M		Ind- phenotype	PMID:2834329^[4]		Both formic acid and hydroxylamine were used as to mutagenize the strain.
lexA262 (Silent SalI site )	GCT->GTT	A83V		Ind- phenotype	PMID:2834329^[4]		Hydroxylamine were used as to mutagenize the strain.
lexA267 (Silent SalI site )	GCT->ACT	A83T		Ind- phenotype	PMID:2834329^[4]		Both hydroxylamine and hydrazine were used as to mutagenize the strain.
lexA252 (Silent SalI site )	GCT->--	A83Δ		Ind- phenotype	PMID:2834329^[4]		Spontaneous mutation
lexA260 (Silent SalI site )	GCC->ACC	A84T		Ind- phenotype	PMID:2834329^[4]		Hydroxylamine was used as to mutagenize the strain.
lexA268 (Silent SalI site )	GCC->GAC	A84D		Ind- phenotype	PMID:2834329^[4]		Formic acid was used as to mutagenize the strain.
lexA3 (Silent SalI site )	GGT->GAT	G85D		Ind- phenotype	PMID:2834329^[4]		Hydrazine was used as to mutagenize the strain.
lexA252 (Silent SalI site )	GAA->AAA	A95K		Ind- phenotype	PMID:2834329^[4]		Spontaneous mutation
lexA274 (Silent SalI site )	GGC->CCC	R114P		Ind- phenotype	PMID:2834329^[4]		Formic acid was used as to mutagenize the strain.
lexA251 (Silent SalI site )	TCG->TTG	S119L		Ind- phenotype	PMID:2834329^[4]		This allele was produced spontaneously and using hydroxylamine.
lexA269 (Silent SalI site )	GTC->TTC	V115F		Ind- phenotype	PMID:2834329^[4]		Formic acid was used as to mutagenize the strain.
lexA280 (Silent SalI site )	ATG->TTG	M120L		Ind- phenotype	PMID:2834329^[4]		Formic acid was used as to mutagenize the strain.
lexA263 (Silent SalI site )	GGG->GAG	G117E		Ind- phenotype	PMID:2834329^[4]		Both formic acid and hydroxylamine were used as to mutagenize the strain.
lexA259 (Silent SalI site )	ACC->ATC	T154I		Ind- phenotype	PMID:2834329^[4]		Both hydrazine and hydroxylamine were used as to mutagenize the strain.
lexA270 (Silent SalI site )	AAG->AGG	K156R		Ind- phenotype	PMID:2834329^[4]		Formic acid was used as to mutagenize the strain.
lexA272 (Silent SalI site )	AAG->ATG	K156M		Ind- phenotype	PMID:2834329^[4]		Formic acid was used as to mutagenize the strain.
lexA271-281		K156N/Q184H		Ind- phenotype	PMID:2834329^[4]		Formic acid was used as to mutagenize the strain.
lexA271 (Silent SalI and BglI site)	AAG->AAT	K156N		Ind- phenotype	PMID:2834329^[4]
lexA281 (Silent SalI and BstI site)	CAG->CAT	Q184H		Ind- phenotype	PMID:2834329^[4]
lexA273-282		K156T/E184V		Ind- phenotype	PMID:2834329^[4]		Formic acid was used as to mutagenize the strain.
lexA273 (Silent SalI and BglI sites)	AAG->ACG	K156T		Ind- phenotype	PMID:2834329^[4]
lexA282 (Silent SalI and BglI sites)	GAA->GTA	E170V		Ind- phenotype	PMID:2834329^[4]
lexA3 in MDS42	deletion		Sensitivity to	increases senstitivity to Bicyclomycin	PMID:21183718^[6]		fig. 2
SMR6039 lexA3(Ind^-)MalB::Tn9	insertion		SOS response	Decrease in spontaneous SOS-induction	PMID:23224554^[7]	Parent Strain: SMR6039 Experimental Strain: SMR6178	The mutation caused a defect in spontaneous SOS-induction. See table S7 for a summary of experimental results.
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW4003	Plasmid clone	Shigen	PMID:16769691^[8] Status:Clone OK Primer 1:GCCAAAGCGTTAACGGCCAGGCA Primer 2:CCaAGCCAGTCGCCGTTGCGAAT
1F8	Kohara Phage	Genobase	PMID:3038334^[9]
12B4	Kohara Phage	Genobase	PMID:3038334^[9]
1E4	Kohara Phage	Genobase	PMID:3038334^[9]
malF3089::Tn10	Linked marker	CAG12164 = CGSC7476^[10]	est. P1 cotransduction: 60% ^[11]
zje-2241::Tn10	Linked marker	CAG18427 = CGSC7481^[10]	est. P1 cotransduction: 9% ^[11]
DM Strain List	Strain	There are several strains with single lexA mutations listed in Table 1.	PMID:4343824^[12]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10533	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10533	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000526	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948544	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0528	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013241	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ Markham, BE et al. (1981) Nucleotide sequence of the lexA gene of Escherichia coli K-12. Nucleic Acids Res. 9 4149-61 PubMed
↑ Peterson, KR et al. (1988) The Escherichia coli K-12 lexA2 gene encodes a hypocleavable repressor. J. Bacteriol. 170 1975-7 PubMed
↑ ^4.00 ^4.01 ^4.02 ^4.03 ^4.04 ^4.05 ^4.06 ^4.07 ^4.08 ^4.09 ^4.10 ^4.11 ^4.12 ^4.13 ^4.14 ^4.15 ^4.16 ^4.17 ^4.18 ^4.19 ^4.20 ^4.21 ^4.22 ^4.23 ^4.24 ^4.25 Lin, LL & Little, JW (1988) Isolation and characterization of noncleavable (Ind-) mutants of the LexA repressor of Escherichia coli K-12. J. Bacteriol. 170 2163-73 PubMed
↑ Froehlich, B (1981) Weigle reactivation of the single-stranded DNA phage f1. Mol. Gen. Genet. 184 416-20 PubMed
↑ Washburn, RS & Gottesman, ME (2011) Transcription termination maintains chromosome integrity. Proc. Natl. Acad. Sci. U.S.A. 108 792-7 PubMed
↑ Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
↑ ^9.0 ^9.1 ^9.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
↑ ^10.0 ^10.1 CGSC: The Coli Genetics Stock Center
↑ ^11.0 ^11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Mount, DW et al. (1972) Dominant mutations (lex) in Escherichia coli K-12 which affect radiation sensitivity and frequency of ultraviolet lght-induced mutations. J. Bacteriol. 112 886-93 PubMed

@@ Line 46: / Line 46: @@
 !align=left {{table_heading_style}} |Synonyms
 ||
-''ECK4035, b4043, JW4003, exrA, tsl, umuA''<ref name='LIB:Riley_2006'/>
+''ECK4035, b4043, JW4003, exrA, tsl, umuA''<ref name='LIB:Riley_2006'/>, spr, umuA''
 |- class="tableEdit_footer"
@@ Line 67: / Line 67: @@
 *
 ****************************************************************************************** -->{{Gene_location_help}}
-{|   id="Q46aa058b0e011"  class=" tableEdit Gene_location_table"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="Q46aa058b0e011"  class=" tableEdit Gene_location_table"
 |- {{table_heading_style}}
 !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
@@ Line 128: / Line 128: @@
 |
 W3110: 4260705..4261313<br /><gbrowseImage>
-name=AC_000091:4260705..4261313
+name=NC_007779:4260705..4261313
 source=W3110
 preset=GeneLocation
@@ Line 134: / Line 134: @@
 |
-{{GBrowseLink|W3110|AC_000091|4259705|4262313|GBrowse(W3110)}}
+{{GBrowseLink|W3110|NC_007779|4259705|4262313|GBrowse(W3110)}}
 |
-{{GBrowseFastaLink|W3110|AC_000091|4260705|4261313|FASTA Dump}}
+{{GBrowseFastaLink|W3110|NC_007779|4260705|4261313|FASTA Dump}}
 |-
 |
@@ Line 172: / Line 172: @@
 *
 ****************************************************************************************** -->{{Gene_sequence_features_help}}
-{|   id="L46aa058bc99aa"  class=" tableEdit Gene_sequence_features_table"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="L46aa058bc99aa"  class=" tableEdit Gene_sequence_features_table"
 |- {{table_heading_style}}
 !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes
@@ Line 194: / Line 194: @@
 *
 ****************************************************************************************** -->{{Gene_alleles_help}}
-{| {{Prettytable}}  id="D46aa058c206f8"  class=" tableEdit Gene_allele_table dataTable"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="D46aa058c206f8"  class=" tableEdit Gene_allele_table dataTable"
 |- {{table_heading_style}}
 !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments
@@ Line 914: / Line 914: @@
 |-
 |
-lexA3 (del) in MDS 42
+lexA3 in [[MDS42]]
 |
+deletion
 |
@@ Line 922: / Line 922: @@
 Sensitivity to
 |
-increases senstitivity to bicyclomycin
+increases senstitivity to [[Bicyclomycin]]
 |
 PMID:21183718
@@ Line 930: / Line 930: @@
 fig. 2
+|-
+|
+SMR6039 ''lexA3(Ind<sup>-</sup>)MalB''::Tn9
+|
+insertion
+|
+|
+SOS response
+|
+Decrease in spontaneous SOS-induction
+|
+PMID:23224554
+|
+Parent Strain: SMR6039
+Experimental Strain: SMR6178
+|
+The mutation caused a defect in spontaneous SOS-induction.  See table S7 for a summary of experimental results.
 |- class="tableEdit_footer"
@@ Line 950: / Line 968: @@
 *
 ****************************************************************************************** -->{{Genetic_interaction_help}}
-{|   id="E4e04be5d4dcbe"  class=" tableEdit Genetic_interaction_table dataTable"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="E4e04be5d4dcbe"  class=" tableEdit Genetic_interaction_table dataTable"
 |- {{table_heading_style}}
 !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes
@@ Line 971: / Line 989: @@
 *
 ****************************************************************************************** -->{{Gene_resources_help}}
-{|   id="K46aa058cdba1d"  class=" tableEdit Gene_resource_table"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="K46aa058cdba1d"  class=" tableEdit Gene_resource_table"
 |- {{table_heading_style}}
 !|Resource!!Resource Type!!Source!!Notes/Reference
@@ Line 1,062: / Line 1,080: @@
 *
 ****************************************************************************************** -->{{Gene_accessions_help}}
-{|   id="A46aa058d892be"  class=" tableEdit Gene_accessions_table"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="A46aa058d892be"  class=" tableEdit Gene_accessions_table"
 |- {{table_heading_style}}
 !|Database!!Accession!!Notes
+|-
+|
+[[EcoCyc]]
+|
+EcoCyc:EG10533
+|
+''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655|MG1655]]
+|-
+|
+[[EcoGene]]
+|
+EcoGene:EG10533
+|
+''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655|MG1655]]
+|-
+|
+[[RegulonDB]]
+|
+RegulonDB:ECK120000526
+|
+''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655|MG1655]]
+|-
+|
+[http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])
+|
+[http://www.ncbi.nlm.nih.gov/gene?term=948544 GeneID:948544]
+|
+Escherichia coli str. K-12 substr. MG1655
+|-
+|
+[[EchoBASE]]
+|
+EchoBASE:EB0528
+|
+''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655|MG1655]]
+|-
+|
+[[ASAP]]
+|
+ASAP:ABE-0013241
+|
+''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655|MG1655]]
 |- class="tableEdit_footer"
@@ Line 1,084: / Line 1,144: @@
 *
 ****************************************************************************************** -->
-{|   id="D46a71ecf03b0b"  class=" tableEdit Links_table"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="D46a71ecf03b0b"  class=" tableEdit Links_table"
 |- {{table_heading_style}}
 !|Name!!URL!!Comments

lexA:Gene: Difference between revisions

Latest revision as of 20:51, 19 September 2013

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

References

Categories

Navigation menu

lexA:Gene: Difference between revisions

Latest revision as of 20:51, 19 September 2013

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

References

Categories

Navigation menu

Search