lexA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
lexA |
|---|---|
| Mnemonic |
Lambda excision |
| Synonyms |
ECK4035, b4043, JW4003, exrA, tsl, umuA[1], spr, umuA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
91.71 minutes |
MG1655: 4255138..4255746 |
||
|
NC_012967: 4236047..4236655 |
||||
|
NC_012759: 4193983..4194591 |
||||
|
W3110 |
|
W3110: 4260705..4261313 |
||
|
DH10B: 4354834..4355442 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
A description of the lexA gene may be found in Markham et al. (1981)[2].
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
lexAG85D |
G85D |
(in lexA3, resistant to cleavage) |
Strain variation; seeded from UniProt:P0A7C2 | ||||
|
lexA107 |
|||||||
|
lexA1(Ind-) |
non-inducible SOS response |
||||||
|
lexA41(ts) |
temperature sensitive |
||||||
|
lexA3(Ind-) |
non-inducible SOS response |
||||||
|
lexA51 |
|||||||
|
lexA101 |
|||||||
|
lexA102 |
|||||||
|
lexA109 |
|||||||
|
lexA103 |
|||||||
|
lexA104 |
|||||||
|
lexA105 |
|||||||
|
lexA106 |
|||||||
|
lexA108 |
|||||||
|
lexA71::Tn5 |
|||||||
|
lexA2 |
C461T |
T154I |
Sensitivity to |
hypocleavable repressor leads to a sensitivity to DNA damage |
|||
|
spr |
uninducible, not cleaved during SOS response | ||||||
|
lexA264 (Silent SalI site ) |
GGT->GTT |
G80V |
Ind- phenotype |
Formic acid was used as the mutagen | |||
|
lexA261 (Silent SalI site ) |
GGT->GAT |
G80D |
Ind- phenotype |
Hydroxylamine was used as the mutagen | |||
|
lexA266 (Silent SalI site ) |
GTG->GAG |
V82E |
Ind- phenotype |
Formic acid was used as the mutagen | |||
|
lexA265 (Silent SalI site ) |
GTG->ATG |
V82M |
Ind- phenotype |
Both formic acid and hydroxylamine were used as to mutagenize the strain. | |||
|
lexA262 (Silent SalI site ) |
GCT->GTT |
A83V |
Ind- phenotype |
Hydroxylamine were used as to mutagenize the strain. | |||
|
lexA267 (Silent SalI site ) |
GCT->ACT |
A83T |
Ind- phenotype |
Both hydroxylamine and hydrazine were used as to mutagenize the strain. | |||
|
lexA252 (Silent SalI site ) |
GCT->-- |
A83Δ |
Ind- phenotype |
Spontaneous mutation | |||
|
lexA260 (Silent SalI site ) |
GCC->ACC |
A84T |
Ind- phenotype |
Hydroxylamine was used as to mutagenize the strain. | |||
|
lexA268 (Silent SalI site ) |
GCC->GAC |
A84D |
Ind- phenotype |
Formic acid was used as to mutagenize the strain. | |||
|
lexA3 (Silent SalI site ) |
GGT->GAT |
G85D |
Ind- phenotype |
Hydrazine was used as to mutagenize the strain. | |||
|
lexA252 (Silent SalI site ) |
GAA->AAA |
A95K |
Ind- phenotype |
Spontaneous mutation | |||
|
lexA274 (Silent SalI site ) |
GGC->CCC |
R114P |
Ind- phenotype |
Formic acid was used as to mutagenize the strain. | |||
|
lexA251 (Silent SalI site ) |
TCG->TTG |
S119L |
Ind- phenotype |
This allele was produced spontaneously and using hydroxylamine. | |||
|
lexA269 (Silent SalI site ) |
GTC->TTC |
V115F |
Ind- phenotype |
Formic acid was used as to mutagenize the strain. | |||
|
lexA280 (Silent SalI site ) |
ATG->TTG |
M120L |
Ind- phenotype |
Formic acid was used as to mutagenize the strain. | |||
|
lexA263 (Silent SalI site ) |
GGG->GAG |
G117E |
Ind- phenotype |
Both formic acid and hydroxylamine were used as to mutagenize the strain. | |||
|
lexA259 (Silent SalI site ) |
ACC->ATC |
T154I |
Ind- phenotype |
Both hydrazine and hydroxylamine were used as to mutagenize the strain. | |||
|
lexA270 (Silent SalI site ) |
AAG->AGG |
K156R |
Ind- phenotype |
Formic acid was used as to mutagenize the strain. | |||
|
lexA272 (Silent SalI site ) |
AAG->ATG |
K156M |
Ind- phenotype |
Formic acid was used as to mutagenize the strain. | |||
|
lexA271-281 |
K156N/Q184H |
Ind- phenotype |
Formic acid was used as to mutagenize the strain. | ||||
|
lexA271 (Silent SalI and BglI site) |
AAG->AAT |
K156N |
Ind- phenotype |
||||
|
lexA281 (Silent SalI and BstI site) |
CAG->CAT |
Q184H |
Ind- phenotype |
||||
|
lexA273-282 |
K156T/E184V |
Ind- phenotype |
Formic acid was used as to mutagenize the strain. | ||||
|
lexA273 (Silent SalI and BglI sites) |
AAG->ACG |
K156T |
Ind- phenotype |
||||
|
lexA282 (Silent SalI and BglI sites) |
GAA->GTA |
E170V |
Ind- phenotype |
||||
|
lexA3 in MDS42 |
deletion |
Sensitivity to |
increases senstitivity to Bicyclomycin |
fig. 2 | |||
|
SMR6039 lexA3(Ind-)MalB::Tn9 |
insertion |
SOS response |
Decrease in spontaneous SOS-induction |
Parent Strain: SMR6039 Experimental Strain: SMR6178 |
The mutation caused a defect in spontaneous SOS-induction. See table S7 for a summary of experimental results. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4003 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAGCGTTAACGGCCAGGCA Primer 2:CCaAGCCAGTCGCCGTTGCGAAT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 60% [11] | ||
|
Linked marker |
est. P1 cotransduction: 9% [11] | ||
|
DM Strain List |
Strain |
There are several strains with single lexA mutations listed in Table 1. |
|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Markham, BE et al. (1981) Nucleotide sequence of the lexA gene of Escherichia coli K-12. Nucleic Acids Res. 9 4149-61 PubMed
- ↑ Peterson, KR et al. (1988) The Escherichia coli K-12 lexA2 gene encodes a hypocleavable repressor. J. Bacteriol. 170 1975-7 PubMed
- ↑ 4.00 4.01 4.02 4.03 4.04 4.05 4.06 4.07 4.08 4.09 4.10 4.11 4.12 4.13 4.14 4.15 4.16 4.17 4.18 4.19 4.20 4.21 4.22 4.23 4.24 4.25 Lin, LL & Little, JW (1988) Isolation and characterization of noncleavable (Ind-) mutants of the LexA repressor of Escherichia coli K-12. J. Bacteriol. 170 2163-73 PubMed
- ↑ Froehlich, B (1981) Weigle reactivation of the single-stranded DNA phage f1. Mol. Gen. Genet. 184 416-20 PubMed
- ↑ Washburn, RS & Gottesman, ME (2011) Transcription termination maintains chromosome integrity. Proc. Natl. Acad. Sci. U.S.A. 108 792-7 PubMed
- ↑ Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 9.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 CGSC: The Coli Genetics Stock Center
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Mount, DW et al. (1972) Dominant mutations (lex) in Escherichia coli K-12 which affect radiation sensitivity and frequency of ultraviolet lght-induced mutations. J. Bacteriol. 112 886-93 PubMed
