yohF:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

yohF

Gene Synonym(s)

ECK2130, b2137, JW2125, yohE[1], yohE

Product Desc.

EG12019[2][3]

RpoS regulon, acid sensitive, induced by ALS inhibition, similarity to insect-type ADH[4]

Product Synonyms(s)

predicted oxidoreductase with NAD(P)-binding Rossmann-fold domain[1], B2137[2][1], YohE[2][1], YohF[2][1] , ECK2130, JW2125, yohE, b2137

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): yohF[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]





Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

yohF

Mnemonic

Systematic nomenclature

Synonyms

ECK2130, b2137, JW2125, yohE[1], yohE

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

47.95 minutes 

MG1655: 2225292..2224531
<gbrowseImage> name=NC_000913:2224531..2225292 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 2178508..2177747
<gbrowseImage> name=NC_012967:2177747..2178508 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 2117014..2117775
<gbrowseImage> name=NC_012759:2117014..2117775 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 2230604..2229843
<gbrowseImage> name=NC_007779:2229843..2230604 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 2316300..2315539
<gbrowseImage> name=NC_010473:2315539..2316300 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔyohF (Keio:JW2125)

deletion

deletion

PMID:16738554

Shigen
CGSC9723[5]

yohF::Tn5KAN-I-SceI (FB20640)

Insertion at nt 461 in Plus orientation

PMID:15262929

E. coli Genome Project:FB20640

contains pKD46

ΔyohF::kan

deletion

Biolog:respiration

unable to respire Acetate

PMID:16095938

δyohF::kan

deletion

Biolog:respiration

unable to respire Acetate

PMID:16095938

ΔyohF::kan

deletion

Biolog:respiration

unable to respire Acetate

PMID:16095938

ΔyohF764::kan

PMID:16738554

CGSC:105888


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2125

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCGCACAGGTTGCGATTATTAC

Primer 2:CCTTCTGGGTTGAACTGTGGATT

1E1

Kohara Phage

Genobase

PMID:3038334

2B2

Kohara Phage

Genobase

PMID:3038334

zbd-3104::Tn10

Linked marker

CAG12021 = CGSC7344[5]

est. P1 cotransduction: 11% [6]
Synonyms:zbc-3105::Tn10, zbd-3105::Tn10

napA722::Tn10

Linked marker

CAG12098 = CGSC7400[5]

est. P1 cotransduction: 1% [6]
Synonyms:zeg-722, zei-722::Tn10

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12019

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12019

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001936

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:949126

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1955

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007062

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

YohF

Synonyms

predicted oxidoreductase with NAD(P)-binding Rossmann-fold domain[1], B2137[2][1], YohE[2][1], YohF[2][1] , ECK2130, JW2125, yohE, b2137

Product description

EG12019[2][3]

RpoS regulon, acid sensitive, induced by ALS inhibition, similarity to insect-type ADH[4]

EC number (for enzymes)


<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0003824

catalytic activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR016040

F

Seeded from EcoCyc (v14.0)

complete

GO:0005488

binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR016040

F

Seeded from EcoCyc (v14.0)

complete

GO:0008152

metabolic process

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR002198

P

Seeded from EcoCyc (v14.0)

complete

GO:0008152

metabolic process

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR002347

P

Seeded from EcoCyc (v14.0)

complete

GO:0008152

metabolic process

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR016040

P

Seeded from EcoCyc (v14.0)

complete

GO:0016491

oxidoreductase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR002198

F

Seeded from EcoCyc (v14.0)

complete

GO:0016491

oxidoreductase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR002347

F

Seeded from EcoCyc (v14.0)

complete

GO:0016491

oxidoreductase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR020904

F

Seeded from EcoCyc (v14.0)

complete

GO:0016491

oxidoreductase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0560

F

Seeded from EcoCyc (v14.0)

complete

GO:0055114

oxidation reduction

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR002347

P

Seeded from EcoCyc (v14.0)

complete

GO:0055114

oxidation reduction

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0560

P

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

nadE

PMID:16606699

Experiment(s):EBI-1142009

Protein

rplD

PMID:16606699

Experiment(s):EBI-1142009

Protein

ydfQ

PMID:16606699

Experiment(s):EBI-1142009

Protein

tauB

PMID:16606699

Experiment(s):EBI-1142009

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MAQVAIITAS DSGIGKECAL LLAQQGFDIG ITWHSDEEGA KDTAREVVSH GVRAEIVQLD
LGNLPEGALA LEKLIQRLGR IDVLVNNAGA MTKAPFLDMA FDEWRKIFTV DVDGAFLCSQ
IAARQMVKQG QGGRIINITS VHEHTPLPDA SAYTAAKHAL GGLTKAMALE LVRHKILVNA
VAPGAIATPM NGMDDSDVKP DAEPSIPLRR FGATHEIASL VVWLCSEGAN YTTGQSLIVD
GGFMLANPQF NPE
Length

253

Mol. Wt

26.95 kDa

pI

5.1 (calculated)

Extinction coefficient

19,480 - 19,855 (calc based on 2 Y, 3 W, and 3 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

3..172

PF00106 short chain dehydrogenase

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=yohF taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16130075

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:949126

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007062

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P33368

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG12019

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12019

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:949126

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001936

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1955

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

Ecoli K-12

18.245+/-0.23

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

Single Molecule Fluorescence

PMID:20671182

mRNA

Ecoli K-12

0.022996058

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

by RNA_Seq

PMID:20671182

Protein

E. coli K-12 MG1655

2a

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Protein

E. coli K-12 MG1655

100

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

0a

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

yohF

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:2225272..2225312 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b2137 (EcoliWiki Page)

NCBI GEO profiles for yohF

microarray

GenExpDB:b2137 (EcoliWiki Page)

Summary of data for yohF from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

<protect></protect>

Notes

Accessions Related to yohF Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12019

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1955

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b2137

EcoGene

EcoGene:EG12019

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001936

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007062

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Bos taurus

  • ENSBTAP00000000813 (score: 1.000; bootstrap: 63%)
  • ENSBTAP00000011525 (score: 1.000; bootstrap: 56%)

From Inparanoid:20070104

Caenorhabditis briggsae

  • WBGene00035307 (score: 1.000; bootstrap: 74%)
  • WBGene00035308 (score: 1.000; bootstrap: 53%)
  • WBGene00028617 (score: 0.174)
  • WBGene00028618 (score: 0.163)
  • WBGene00033128 (score: 0.153)
  • WBGene00033127 (score: 0.150)
  • WBGene00028619 (score: 0.142)
  • WBGene00033126 (score: 0.130)
  • WBGene00031245 (score: 0.116)
  • WBGene00041131 (score: 0.108)
  • WBGene00028621 (score: 0.100)
  • WBGene00028504 (score: 0.097)
  • WBGene00033125 (score: 0.097)
  • WBGene00039097 (score: 0.097)
  • WBGene00041130 (score: 0.095)
  • WBGene00028648 (score: 0.092)
  • WBGene00040923 (score: 0.089)
  • WBGene00031232 (score: 0.087)
  • WBGene00042377 (score: 0.087)
  • WBGene00033122 (score: 0.082)
  • WBGene00031193 (score: 0.079)
  • WBGene00040924 (score: 0.071)
  • WBGene00033120 (score: 0.071)
  • WBGene00033123 (score: 0.068)
  • WBGene00028201 (score: 0.062)
  • WBGene00028200 (score: 0.054)

From Inparanoid:20070104

Caenorhabditis elegans

  • WBGene00021646 (score: 1.000; bootstrap: 65%)
  • WBGene00021647 (score: 0.794)
  • WBGene00000977 (score: 0.158)
  • WBGene00019886 (score: 0.152)
  • WBGene00000978 (score: 0.136)
  • WBGene00008375 (score: 0.120)
  • WBGene00007245 (score: 0.112)
  • WBGene00009110 (score: 0.110)
  • WBGene00020151 (score: 0.107)
  • WBGene00015532 (score: 0.104)
  • WBGene00019885 (score: 0.099)
  • WBGene00000986 (score: 0.099)
  • WBGene00014093 (score: 0.094)
  • WBGene00008516 (score: 0.094)
  • WBGene00009153 (score: 0.091)
  • WBGene00017408 (score: 0.088)
  • WBGene00020154 (score: 0.080)
  • WBGene00009236 (score: 0.078)
  • WBGene00021003 (score: 0.053)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000008886 (score: 1.000; bootstrap: 75%)

From Inparanoid:20070104

Danio rerio

  • ZDB-GENE-030131-7002 (score: 1.000; bootstrap: 76%)

From Inparanoid:20070104

Monodelphis domestica

  • ENSMODP00000003966 (score: 1.000; bootstrap: 61%)
  • ENSMODP00000003989 (score: 0.608)

From Inparanoid:20070104

Takifugu rubripes

  • NEWSINFRUP00000129614 (score: 1.000; bootstrap: 80%)

From Inparanoid:20070104

E. coli O157

YOHF

From ECOO157CYC


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF00106 short chain dehydrogenase

Superfamily (EcoliWiki Page)

SUPERFAMILY:51735

EcoCyc

EcoCyc:EG12019

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12019

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001936

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1955

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007062

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories

[back to top]