wcaA:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

wcaA

Gene Synonym(s)

ECK2053, b2059, JW2044[1], JW2044

Product Desc.

predicted colanic acid biosynthesis glycosyl transferase[2][3]

Putative colanic acid biosynthesis glycosyl transferase[4]

Product Synonyms(s)

predicted glycosyl transferase[1], B2059[2][1], WcaA[2][1] , ECK2053, JW2044, b2059

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): wza-wzb-wzc-wcaAB[2], OP00290, cps, cpsB, cpsGB

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]





Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

wcaA

Mnemonic

Systematic nomenclature

Synonyms

ECK2053, b2059, JW2044[1], JW2044

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

45.92 minutes 

MG1655: 2131421..2130582
<gbrowseImage> name=NC_000913:2130582..2131421 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 2066603..2065764
<gbrowseImage> name=NC_012967:2065764..2066603 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 2023065..2023904
<gbrowseImage> name=NC_012759:2023065..2023904 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 2135534..2134695
<gbrowseImage> name=NC_007779:2134695..2135534 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 2222429..2221590
<gbrowseImage> name=NC_010473:2221590..2222429 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔwcaA (Keio:JW2044)

deletion

deletion

PMID:16738554

Shigen
CGSC9679[5]

ΔwcaA::kan

deletion

Biolog:respiration

unable to respire Acetate

PMID:16095938

ΔwcaA757::kan

PMID:16738554

CGSC:103368


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2044

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAAAAACAATCCGCTGATCTC

Primer 2:CCGCGCCCCCGAATACCATCAGC

10A9

Kohara Phage

Genobase

PMID:3038334

7A3

Kohara Phage

Genobase

PMID:3038334

2E1

Kohara Phage

Genobase

PMID:3038334

zef-3129::Tn10

Linked marker

CAG12099 = CGSC7397[5]

est. P1 cotransduction: 12% [6]
Synonyms:zee-3129::Tn10

zbd-3104::Tn10

Linked marker

CAG12021 = CGSC7344[5]

est. P1 cotransduction: 13% [6]
Synonyms:zbc-3105::Tn10, zbd-3105::Tn10

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7104

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG13569

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003690

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946570

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3339

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0006816

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

WcaA

Synonyms

predicted glycosyl transferase[1], B2059[2][1], WcaA[2][1] , ECK2053, JW2044, b2059

Product description

predicted colanic acid biosynthesis glycosyl transferase[2][3]

Putative colanic acid biosynthesis glycosyl transferase[4]

EC number (for enzymes)


<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0009103

lipopolysaccharide biosynthetic process

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0448

P

Seeded from EcoCyc (v14.0)

complete

GO:0016740

transferase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0808

F

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

fliF

PMID:16606699

Experiment(s):EBI-1141792

Protein

fur

PMID:16606699

Experiment(s):EBI-1141792

Protein

rplF

PMID:16606699

Experiment(s):EBI-1141792

Protein

groL

PMID:16606699

Experiment(s):EBI-1141792

Protein

ydhY

PMID:16606699

Experiment(s):EBI-1141792

Protein

nadE

PMID:16606699

Experiment(s):EBI-1141792

Protein

rpsC

PMID:16606699

Experiment(s):EBI-1141792

Protein

prs

PMID:16606699

Experiment(s):EBI-1141792

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MKNNPLISIY MPTWNRQQLA IRAIKSVLRQ DYSNWEMIIV DDCSTSWEQL QQYVTALNDP
RITYIHNDIN SGACAVRNQA IMLAQGEYIT GIDDDDEWTP NRLSVFLAHK QQLVTHAFLY
ANDYVCQGEV YSQPASLPLY PKSPYSRRLF YKRNIIGNQV FTWAWRFKEC LFDTELKAAQ
DYDIFLRMVV EYGEPWKVEE ATQILHINHG EMQITSSPKK FSGYFHFYRK HKDKFDRASK
KYQLFTLYQI RNKRMTWRTL LTLLSVRNGK RLADGIRGR
Length

279

Mol. Wt

33.035 kDa

pI

9.6 (calculated)

Extinction coefficient

69,330 - 69,830 (calc based on 17 Y, 8 W, and 4 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

8..172

PF00535 Glycosyl transferase family 2

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=wcaA taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16129999

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:946570

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0006816

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P77414

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:G7104

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG13569

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:946570

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003690

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3339

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MG1655

0a

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Protein

E. coli K-12 MG1655

3a

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Protein

E. coli K-12 MG1655

0a

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

wza-wzb-wzc-wcaAB

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:2131401..2131441 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b2059 (EcoliWiki Page)

NCBI GEO profiles for wcaA

microarray

GenExpDB:b2059 (EcoliWiki Page)

Summary of data for wcaA from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

<protect></protect>

Notes

Accessions Related to wcaA Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7104

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3339

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b2059

EcoGene

EcoGene:EG13569

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003690

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0006816

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


<protect> See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

</protect>


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF00535 Glycosyl transferase family 2

Superfamily (EcoliWiki Page)

SUPERFAMILY:53448

EcoCyc

EcoCyc:G7104

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG13569

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003690

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3339

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0006816

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories

[back to top]