uvrY:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
uvrY |
|---|---|
| Gene Synonym(s) |
ECK1913, b1914, JW1899, yecB[1], gacA, sirA, yecB |
| Product Desc. |
UvrY transcriptional regulator[2][3] Response regulator, pleiotrpic; controls the expression of csrB/C sRNAs; hydrogen peroxide resistance; cognate sensorregulator is BarA[4] |
| Product Synonyms(s) |
DNA-binding response regulator in two-component regulatory system with BarA [1], YecB [2][1], B1914 [2][1], UvrY-Pasp [2][1] , ECK1913, gacA, JW1899, sirA, yecB, b1914 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Salmonella ortholog regulates virulence gene expression.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
uvrY |
|---|---|
| Mnemonic |
UV resistant |
| Synonyms |
ECK1913, b1914, JW1899, yecB[1], gacA, sirA, yecB |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
42.95 minutes |
MG1655: 1993383..1992727 |
||
|
NC_012967: 1973205..1972696 |
||||
|
NC_012759: 1885210..1885866 |
||||
|
W3110 |
|
W3110: 1997496..1996840 |
||
|
DH10B: 2084391..2083735 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
uvrY(del) (Keio:JW1899) |
deletion |
deletion |
PMID:16738554 |
||||
|
uvrY1310(del) |
PMID:12897016 |
||||||
|
uvrY1362(del) |
|||||||
|
uvrY1296(del) |
PMID:12366850 |
||||||
|
uvrY760(del)::kan |
PMID:16738554 |
||||||
|
uvrY760(del)::FRT |
Mutagenesis rate |
Decreased stress-induced mutagenesis (SIM) phenotype. |
PMID:23224554 |
Parental Strain: SMR4562 Experimental Strain: SMR12314 |
Mutation Rate was comparatively weak, to other strains, with decrease only happening in 33-67% of wild type population. | ||
|
uvrY760(del)::FRT |
Sensitivity to |
An increase in UV Sensitivity. Supplemental Table S7 & S1. |
PMID:23224554 |
Parental Strain: SMR4562 Experimental Strain: SMR12050 |
See Table S1 & S7 | ||
|
SMR6039 uvrY760(del)::FRTkanFRT |
deletion |
SOS response |
Decrease in spontaneous SOS-induction defective. |
PMID:23224554 |
Parental Strain: SMR6039 Experimental Strain: SMR15980 |
See table S7 for a summary of experimental results. | |
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1899 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCATCAACGTTCTACTTGTTGA Primer 2:CCtTGACTTGATAATGTCTCCGC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 93% [6] | ||
|
Linked marker |
est. P1 cotransduction: 14% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11140 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11140 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001124 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB1130 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0006373 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
UvrY |
|---|---|
| Synonyms |
DNA-binding response regulator in two-component regulatory system with BarA [1], YecB [2][1], B1914 [2][1], UvrY-Pasp [2][1] , ECK1913, gacA, JW1899, sirA, yecB, b1914 |
| Product description |
UvrY transcriptional regulator[2][3] Response regulator, pleiotrpic; controls the expression of csrB/C sRNAs; hydrogen peroxide resistance; cognate sensorregulator is BarA[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0000156 |
two-component response regulator activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001789 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000160 |
two-component signal transduction system (phosphorelay) |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001789 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000160 |
two-component signal transduction system (phosphorelay) |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0902 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005622 |
intracellular |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001789 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0043565 |
sequence-specific DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions
See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
lpdA |
PMID:15690043 |
Experiment(s):EBI-880857 | |
|
Protein |
tufA |
PMID:15690043 |
Experiment(s):EBI-880857 | |
|
Protein |
hscC |
PMID:15690043 |
Experiment(s):EBI-887064 | |
|
Protein |
fimZ |
PMID:15690043 |
Experiment(s):EBI-887064 | |
|
Protein |
rplL |
PMID:15690043 |
Experiment(s):EBI-887064 | |
|
Protein |
yghW |
PMID:16606699 |
Experiment(s):EBI-1141304 | |
|
Protein |
rpsM |
PMID:16606699 |
Experiment(s):EBI-1141304 | |
|
Protein |
narX |
PMID:16606699 |
Experiment(s):EBI-1141304 | |
|
Protein |
ahpF |
PMID:16606699 |
Experiment(s):EBI-1141304 | |
|
Protein |
yciH |
PMID:16606699 |
Experiment(s):EBI-1141304 | |
|
Protein |
murB |
PMID:16606699 |
Experiment(s):EBI-1141304 | |
|
Protein |
nagZ |
PMID:16606699 |
Experiment(s):EBI-1141304 | |
|
Protein |
tufB |
PMID:19402753 |
MALDI(Z-score):18.715338 | |
|
Protein |
hscC |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
fimZ |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rplL |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
| edit table |
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MINVLLVDDH ELVRAGIRRI LEDIKGIKVV GEASCGEDAV KWCRTNAVDV VLMDMSMPGI GGLEATRKIA RSTADVKIIM LTVHTENPLP AKVMQAGAAG YLSKGAAPQE VVSAIRSVYS GQRYIASDIA QQMALSQIEP EKTESPFASL SERELQIMLM ITKGQKVNEI SEQLNLSPKT VNSYRYRMFS KLNIHGDVEL THLAIRHGLC NAETLSSQ |
| Length |
218 |
| Mol. Wt |
23.892 kDa |
| pI |
7.0 (calculated) |
| Extinction coefficient |
12,950 - 13,325 (calc based on 5 Y, 1 W, and 3 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0006373 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG11140 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11140 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001124 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1130 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
Ecoli K-12 |
29.111+/-0.225 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
|
mRNA |
Ecoli K-12 |
0.138719512 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
|
Protein |
E. coli K-12 MG1655 |
880 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
412 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
722 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1993363..1993403
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for uvrY | |
|
microarray |
Summary of data for uvrY from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (1993282..1993900) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to uvrY Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11140 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1130 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11140 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001124 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0006373 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
UVRY |
From SHIGELLACYC |
|
E. coli O157 |
UVRY |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11140 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11140 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001124 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1130 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0006373 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories


