umuC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
umuC |
---|---|
Mnemonic |
UV mutator |
Synonyms |
ECK1172, b1184, JW1173, uvm[1], uvm |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
26.52 minutes |
MG1655: 1230409..1231677 |
||
NC_012967: 1231336..1232604 |
||||
NC_012759: 1119130..1120398 |
||||
W3110 |
|
W3110: 1232763..1234031 |
||
DH10B: 1270650..1271918 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
umuC(del) (Keio:JW1173) |
deletion |
deletion |
|||||
umuC::Tn5KAN-2 (FB20263) |
Insertion at nt 565 in Plus orientation |
does not contain pKD46 | |||||
umuCE75K |
E75K |
In umuC36; non-mutable |
seeded from UniProt:P04152 | ||||
umuCD101N |
D101N |
In umuC104; non-mutable |
seeded from UniProt:P04152 | ||||
umuCT290K |
T290K |
In umuC25; non-mutable |
seeded from UniProt:P04152 | ||||
umuC36 |
|||||||
umuC122::Tn5 |
|||||||
umuC104 |
|||||||
umuC25 |
|||||||
umuC773(del)::kan |
|||||||
umuD'C N32A |
Changing the amino acid Alanine at the 32 position causing the deletion of umuD'C |
Sensitivity to |
Increase sensitivity to UV radiation |
See Fig 2A | |||
umuD'C N33A |
Changing the amino acid Alanine at the 33 position causing the deletion of umuD'C |
Sensitivity to |
Increased sensitivity to UV radiation |
See Fig 2A | |||
umuD'C D34A |
Changing the amino acid Alanine at the 32 position causing the deletion of umuD'C |
Sensitivity to |
Increase sensitivity to UV radiation |
See Fig 2A | |||
umuD'C(del) D34N |
Substitution of ending amino acid to Asn |
Ala to Asn |
Sensitivity to |
Increase sensitivity to UV radiation |
See Fig 2B | ||
umuD'C(del) D34E |
Substitution of ending amino acid to Glu |
Ala to Glu |
Sensitivity to |
Increase sensitivity to UV radiation |
See Fig 2B | ||
umuDC E15D |
Over expression of Beta processivity clamp |
E to D. |
Sensitivity to |
There is decrease in the sensitivity of cold. |
See figures 1A and 1B | ||
(umuDC)595(del)::cat |
Deletion of umuDC operon and replaced with chloramephenicol acetylransferase gene (cat) |
Sensitivity to |
Sensitivity toward UV radiation was moderately increased. |
RW82 7280 |
See Figure 1. | ||
polB(del)umuDC(del) |
Deletion of araD-polB operon and replaced with omega cassette. Deletion of umuDC operon and replaced with chloramephenicol acetylransferase gene (cat) |
Sensitivity to |
Sensitivity toward UV radiation was increased by 2 to 3 fold. |
See Figure 1. | |||
(umuDC)595(del)::cat |
Deletion of umuDC operon and replaced with chloramephenicol acetylransferase gene (cat) |
Rate of replication |
There was a slight delay in the resumption of DNA replication after exposure to UV radiation. |
RW82 7280 |
See Figure 2 | ||
polB(del)umuDC(del) |
Deletion of araD-polB operon and replaced with omega cassette. Deletion of umuDC operon and replaced with chloramephenicol acetylransferase gene (cat) |
rate of replication |
There was a significant delay in the resumption of DNA replication after exposure to UV radiation. |
See Figure 3. | |||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW1173 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTTTGCCCTCTGTGATGTAAA Primer 2:CCTTTGACCCTCAGTAAATCAGA | |
Kohara Phage |
|||
Kohara Phage |
|||
Linked marker |
est. P1 cotransduction: 49% [10] | ||
Linked marker |
est. P1 cotransduction: 88% [10] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 5.0 5.1 5.2 5.3 5.4 Hawver, LA et al. (2011) Characterization of Escherichia coli UmuC active-site loops identifies variants that confer UV hypersensitivity. J. Bacteriol. 193 5400-11 PubMed
- ↑ Beuning, PJ et al. (2009) Characterization of novel alleles of the Escherichia coli umuDC genes identifies additional interaction sites of UmuC with the beta clamp. J. Bacteriol. 191 5910-20 PubMed
- ↑ 7.0 7.1 7.2 7.3 Rangarajan, S et al. (1999) A phenotype for enigmatic DNA polymerase II: a pivotal role for pol II in replication restart in UV-irradiated Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 96 9224-9 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).